MirGeneDB

MirGeneDB ID

Dme-Mir-9-P11

Family name MIR-9 (all species)
Seed UAAAGCU
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-4
Paralogues Dme-Mir-9-P7  Dme-Mir-9-P8  Dme-Mir-9-P9  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2 
Orthologues Bge-Mir-9-o11  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P11  Dmo-Mir-9-P11  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(dm6)
chr2R: 19661300-19661356 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P11)
Mir-2-P6c chr2R: 19660722-19660787 [-] UCSC Ensembl
Mir-2-P6b chr2R: 19660874-19660935 [-] UCSC Ensembl
Mir-2-P6a chr2R: 19661012-19661074 [-] UCSC Ensembl
Mir-2-P5 chr2R: 19661162-19661222 [-] UCSC Ensembl
Mir-9-P11 chr2R: 19661300-19661356 [-] UCSC Ensembl
Mir-279-P2 chr2R: 19661435-19661509 [-] UCSC Ensembl
Mir-3-P1 chr2R: 19661600-19661656 [-] UCSC Ensembl
Mir-3-P2 chr2R: 19661710-19661768 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAUAUUAUGGAGCGGUUGCAAUUAGUUUCUUUGGUCGUCCAGCCUUAGGUGAUUUUUCCGGUCAUAAAGCUAGACAACCAUUGAAGUUCGUUGUGGCAUUAGCAGCACCACGAGU
Get precursor sequence
Structure
        10          20        30        40        50         
AAAAUAUUAUGGAGCGG--|UG    U GU   UU    C   C   CUUAG    UUUU 
                   U  CAAU A  UUC  UGGU GUC AGC     GUGA    \
                   G  GUUG U  AAG  ACCA CAG UCG     UACU    U
UGAGCACCACGACGAUUAC^GU    C UG   UU    A   A   AAA--    GGCC 
     110       100        90        80        70          60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-9-P11_5p*

MirBase accessionMIMAT0020785
Sequence
0- CUUUGGUCGUCCAGCCUUAGGUGA -24
Get sequence
Mature sequence

Dme-Mir-9-P11_3p

MirBase accessionMIMAT0000109
Sequence
35- AUAAAGCUAGACAACCAUUGAA -57
Get sequence
Validated targets microrna.org: MIMAT0000109
TargetScanFly: dme-miR-4