MirGeneDB

MirGeneDB ID

Isc-Mir-8

Family name MIR-8 (all species)
Seed AAUACUG
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-8
Paralogues
Orthologues Aae-Mir-8  Aca-Mir-8-P1a  Aca-Mir-8-P2a  Aca-Mir-8-P3a  Ami-Mir-8-P1a  Ami-Mir-8-P2a  Ami-Mir-8-P3a  Asu-Mir-8  Bfl-Mir-8-P1  Bfl-Mir-8-P2-v1  Bfl-Mir-8-P2-v2  Bfl-Mir-8-P3  Bge-Mir-8  Bta-Mir-8-P1a  Bta-Mir-8-P1b  Bta-Mir-8-P2a  Bta-Mir-8-P2b  Bta-Mir-8-P3a  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P1a  Cfa-Mir-8-P1b  Cfa-Mir-8-P2a  Cfa-Mir-8-P2b  Cfa-Mir-8-P3a  Cgi-Mir-8  Cin-Mir-8-P1  Cin-Mir-8-P2  Cin-Mir-8-P2-as  Cli-Mir-8-P1a  Cli-Mir-8-P2a  Cli-Mir-8-P3a  Cpi-Mir-8-P1a  Cpi-Mir-8-P2a  Cpi-Mir-8-P3a  Cpo-Mir-8-P1a  Cpo-Mir-8-P1b  Cpo-Mir-8-P2a  Cpo-Mir-8-P2b  Cpo-Mir-8-P3a  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P1a  Dno-Mir-8-P1b  Dno-Mir-8-P2a  Dno-Mir-8-P3a  Dpu-Mir-8  Dre-Mir-8-P1a  Dre-Mir-8-P1b  Dre-Mir-8-P2a  Dre-Mir-8-P2b  Dre-Mir-8-P3a  Dre-Mir-8-P3b  Efe-Mir-8-P4  Efe-Mir-8-P5  Efe-Mir-8-P6  Ete-Mir-8-P1a  Ete-Mir-8-P1b  Ete-Mir-8-P2a  Ete-Mir-8-P2b  Ete-Mir-8-P3a  Gga-Mir-8-P1a  Gga-Mir-8-P2a  Gga-Mir-8-P3a  Hme-Mir-8  Hsa-Mir-8-P1a  Hsa-Mir-8-P1b  Hsa-Mir-8-P2a  Hsa-Mir-8-P2b  Hsa-Mir-8-P3a  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P1a  Mdo-Mir-8-P1b  Mdo-Mir-8-P2a  Mdo-Mir-8-P2b  Mdo-Mir-8-P3a  Mml-Mir-8-P1a  Mml-Mir-8-P1b  Mml-Mir-8-P2a  Mml-Mir-8-P2b  Mml-Mir-8-P3a  Mmu-Mir-8-P1a  Mmu-Mir-8-P1b  Mmu-Mir-8-P2a  Mmu-Mir-8-P2b  Mmu-Mir-8-P3a  Oan-Mir-8-P1a  Oan-Mir-8-P1b  Oan-Mir-8-P2a  Oan-Mir-8-P2b  Oan-Mir-8-P3a  Ocu-Mir-8-P1a  Ocu-Mir-8-P1b  Ocu-Mir-8-P2a  Ocu-Mir-8-P2b  Ocu-Mir-8-P3a  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P1a  Rno-Mir-8-P1b  Rno-Mir-8-P2a  Rno-Mir-8-P2b  Rno-Mir-8-P3a  Sha-Mir-8-P1a  Sha-Mir-8-P1b  Sha-Mir-8-P2a  Sha-Mir-8-P2b  Sha-Mir-8-P3a  Sko-Mir-8  Spu-Mir-8  Sto-Mir-8-P1a  Sto-Mir-8-P2a  Sto-Mir-8-P3a  Tgu-Mir-8-P1a  Tgu-Mir-8-P2a  Xtr-Mir-8-P1a  Xtr-Mir-8-P2a  Xtr-Mir-8-P3a 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS755496: 12166-12224 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCGGGGCCAGCGACCGAGCACCCGUCAACAUCUUACCAGACAGCAUUAGAUUGAGCCUGAUUUCUAAUACUGUCAGGUAAAGAUGUCCGCGGGAACGCUGUGGAAUGCGGCGUGGGA
Get precursor sequence
Structure
        10        20          30         40        50        
AAGCGGGGCCAGCGACCG   A--     CA     -|    A     C      UUGAG 
                  AGC   CCCGU  ACAUC UUACC GACAG AUUAGA     C
                  UCG   GGGCG  UGUAG AAUGG CUGUC UAAUCU     C
AGGGUGCGGCGUAAGGUG   CAA     CC     A^    A     A      UUAGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-8_5p*

MirBase accessionNone
Sequence
0- CAUCUUACCAGACAGCAUUAGA -22
Get sequence
Mature sequence

Isc-Mir-8_3p

MirBase accessionMIMAT0012706
Sequence
36- UAAUACUGUCAGGUAAAGAUGUC -59
Get sequence