MirGeneDB

MirGeneDB ID

Mmu-Mir-8-P1b

Family name MIR-8 (all species)
Seed AACACUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-141
Paralogues Mmu-Mir-8-P1a  Mmu-Mir-8-P2a  Mmu-Mir-8-P2b  Mmu-Mir-8-P3a 
Orthologues Aae-Mir-8  Asu-Mir-8  Bfl-Mir-8-P1  Bge-Mir-8  Bta-Mir-8-P1b  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P1b  Cgi-Mir-8  Cin-Mir-8-P1  Cpo-Mir-8-P1b  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P1b  Dpu-Mir-8  Dre-Mir-8-P1b  Ete-Mir-8-P1b  Hme-Mir-8  Hsa-Mir-8-P1b  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P1b  Mml-Mir-8-P1b  Oan-Mir-8-P1b  Ocu-Mir-8-P1b  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P1b  Sha-Mir-8-P1b  Sko-Mir-8  Spu-Mir-8 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr6: 124717916-124717980 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P1b)
Mir-8-P1b chr6: 124717916-124717980 [-] UCSC Ensembl
Mir-8-P2b chr6: 124718324-124718386 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAUCAAUUUAUAUUGGCUGGCUCUGGGUCCAUCUUCCAGUGCAGUGUUGGAUGGUUGAAGUAUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCCCCCGGGUCAGUUCCUUCAGCAGUGACCUU
Get precursor sequence
Structure
        10          20        30          40        50        60 
AGAUCAAUUUAUAUUGG--       U   U       --|   U          AUGGUUGAA 
                   CUGGCUC GGG CCAUCUU  CCAG GCAGUGUUGG         G
                   GACUGGG CCC GGUAGAA  GGUC UGUCACAAUC         U
UUCCAGUGACGACUUCCUU       C   C       AU^   -          CUCGAAGUA 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-8-P1b_5p*

MirBase accessionMIMAT0004533
Sequence
0- CAUCUUCCAGUGCAGUGUUGGA -22
Get sequence
Validated targets microrna.org: MIMAT0004533
TargetScanVert: mmu-miR-141-5p
miRDB: MIMAT0004533
Mature sequence

Mmu-Mir-8-P1b_3p

MirBase accessionMIMAT0000153
Sequence
42- UAACACUGUCUGGUAAAGAUGGC -65
Get sequence
Validated targets microrna.org: MIMAT0000153
TargetScanVert: mmu-miR-141-3p
miRDB: MIMAT0000153