MirGeneDB

MirGeneDB ID

Mmu-Mir-8-P2b

Family name MIR-8 (all species)
Seed AAUACUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-200c
Paralogues Mmu-Mir-8-P1a  Mmu-Mir-8-P1b  Mmu-Mir-8-P2a  Mmu-Mir-8-P3a 
Orthologues Aae-Mir-8  Asu-Mir-8  Bfl-Mir-8-P2-v1  Bfl-Mir-8-P2-v2  Bge-Mir-8  Bta-Mir-8-P2b  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P2b  Cgi-Mir-8  Cin-Mir-8-P2  Cin-Mir-8-P2-as  Cpo-Mir-8-P2b  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dpu-Mir-8  Dre-Mir-8-P2b  Ete-Mir-8-P2b  Hme-Mir-8  Hsa-Mir-8-P2b  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P2b  Mml-Mir-8-P2b  Oan-Mir-8-P2b  Ocu-Mir-8-P2b  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P2b  Sha-Mir-8-P2b  Sko-Mir-8  Spu-Mir-8 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr6: 124718324-124718386 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P2b)
Mir-8-P1b chr6: 124717916-124717980 [-] UCSC Ensembl
Mir-8-P2b chr6: 124718324-124718386 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGAAGGUGGACUGGUUGGGUAGGGGCCCUCGUCUUACCCAGCAGUGUUUGGGUGCUGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGGCCCCUGUCCCAGUGUCAUCGGCGUCCAU
Get precursor sequence
Structure
        10         20         30         40        50        60
UUGAAGGUGGACUGGUU-   -        CU    -|     A        U  GUGCUGG 
                  GGG UAGGGGCC  CGUC UUACCC GCAGUGUU GG       U
                  CCC GUCCCCGG  GUAG AAUGGG CGUCAUAA CU       U
UACCUGCGGCUACUGUGA   U        AG    U^     C        U  CUGAGGG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-8-P2b_5p*

MirBase accessionMIMAT0004663
Sequence
0- CGUCUUACCCAGCAGUGUUUGG -22
Get sequence
Validated targets microrna.org: MIMAT0004663
TargetScanVert: mmu-miR-200c-5p
miRDB: MIMAT0004663
Mature sequence

Mmu-Mir-8-P2b_3p

MirBase accessionMIMAT0000657
Sequence
40- UAAUACUGCCGGGUAAUGAUGGA -63
Get sequence
Validated targets microrna.org: MIMAT0000657
TargetScanVert: mmu-miR-200c-3p
miRDB: MIMAT0000657