MirGeneDB

MirGeneDB ID

Bta-Mir-8-P2b

Family name MIR-8 (all species)
Seed AAUACUG
Species Cow (Bos taurus)
MiRBase ID bta-mir-200c
Paralogues Bta-Mir-8-P1a  Bta-Mir-8-P1b  Bta-Mir-8-P2a  Bta-Mir-8-P3a 
Orthologues Aae-Mir-8  Asu-Mir-8  Bfl-Mir-8-P2-v1  Bfl-Mir-8-P2-v2  Bge-Mir-8  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P2b  Cgi-Mir-8  Cin-Mir-8-P2  Cin-Mir-8-P2-as  Cpo-Mir-8-P2b  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dpu-Mir-8  Dre-Mir-8-P2b  Ete-Mir-8-P2b  Hme-Mir-8  Hsa-Mir-8-P2b  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P2b  Mml-Mir-8-P2b  Mmu-Mir-8-P2b  Oan-Mir-8-P2b  Ocu-Mir-8-P2b  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P2b  Sha-Mir-8-P2b  Sko-Mir-8  Spu-Mir-8 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr5: 103859438-103859500 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P2b)
Mir-8-P1b chr5: 103859015-103859079 [-] UCSC Ensembl
Mir-8-P2b chr5: 103859438-103859500 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCUGGAUGGGUGGCGGGGUGGGGGCCCCCGUCUUACCCAGCAGUGUUUGGGUGCUGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGGCCCCUGUCUCAGUGCCAGCGACGUCCAC
Get precursor sequence
Structure
        10          20        30         40        50        60
GCUCUGGAUGGGUGGCG--   UG      C     -|     A        U  GUGCUGG 
                   GGG  GGGGCC CCGUC UUACCC GCAGUGUU GG       U
                   UCU  CCCCGG GGUAG AAUGGG CGUCAUAA CU       U
CACCUGCAGCGACCGUGAC   GU      A     U^     C        U  CUGAGGG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-8-P2b_5p*

MirBase accessionNone
Sequence
0- CGUCUUACCCAGCAGUGUUUGG -22
Get sequence
Mature sequence

Bta-Mir-8-P2b_3p

MirBase accessionMIMAT0003823
Sequence
40- UAAUACUGCCGGGUAAUGAUGGA -63
Get sequence
Validated targets TargetScanVert: bta-miR-200c