MirGeneDB

MirGeneDB ID

Bta-Mir-8-P2a

Family name MIR-8 (all species)
Seed AAUACUG
Species Cow (Bos taurus)
MiRBase ID bta-mir-200b
Paralogues Bta-Mir-8-P1a  Bta-Mir-8-P1b  Bta-Mir-8-P2b  Bta-Mir-8-P3a 
Orthologues Aae-Mir-8  Aca-Mir-8-P2a  Ami-Mir-8-P2a  Asu-Mir-8  Bfl-Mir-8-P2-v1  Bfl-Mir-8-P2-v2  Bge-Mir-8  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P2a  Cgi-Mir-8  Cin-Mir-8-P2  Cin-Mir-8-P2-as  Cli-Mir-8-P2a  Cpi-Mir-8-P2a  Cpo-Mir-8-P2a  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P2a  Dpu-Mir-8  Dre-Mir-8-P2a  Ete-Mir-8-P2a  Gga-Mir-8-P2a  Hme-Mir-8  Hsa-Mir-8-P2a  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P2a  Mml-Mir-8-P2a  Mmu-Mir-8-P2a  Oan-Mir-8-P2a  Ocu-Mir-8-P2a  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P2a  Sha-Mir-8-P2a  Sko-Mir-8  Spu-Mir-8  Sto-Mir-8-P2a  Tgu-Mir-8-P2a  Xtr-Mir-8-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr16: 52521991-52522049 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P2a)
Mir-8-P3a chr16: 52520100-52520157 [-] UCSC Ensembl
Mir-8-P1a chr16: 52521336-52521396 [-] UCSC Ensembl
Mir-8-P2a chr16: 52521991-52522049 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCAAGACCCAAUCCGGGGUGGCCAUCGCCAUCUUACUGGGCAGCAUUGGAUGGUGUCUGGUCUCUAAUACUGCCUGGUAAUGAUGACGCUGGGGCCCUGCUCGCAGCGACGGGGCCG
Get precursor sequence
Structure
        10           20        30         40        50        
CCCCAAGACCCAAUCCG---|   GG   U  C    -    UG     C      UGGUG 
                    GGGU  CCA CG CAUC UUAC  GGCAG AUUGGA     U
                    CCCG  GGU GC GUAG AAUG  CCGUC UAAUCU     C
GCCGGGGCAGCGACGCUCGU^   G-   C  A    U    GU     A      CUGGU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-8-P2a_5p*

MirBase accessionNone
Sequence
0- CAUCUUACUGGGCAGCAUUGGA -22
Get sequence
Mature sequence

Bta-Mir-8-P2a_3p

MirBase accessionMIMAT0003842
Sequence
36- UAAUACUGCCUGGUAAUGAUGAC -59
Get sequence
Validated targets TargetScanVert: bta-miR-200b