MirGeneDB

MirGeneDB ID

Aca-Mir-8-P2a

Family name MIR-8 (all species)
Seed AAUACUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-200b
Paralogues Aca-Mir-8-P1a  Aca-Mir-8-P3a 
Orthologues Aae-Mir-8  Ami-Mir-8-P2a  Asu-Mir-8  Bfl-Mir-8-P2-v1  Bfl-Mir-8-P2-v2  Bge-Mir-8  Bta-Mir-8-P2a  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P2a  Cgi-Mir-8  Cin-Mir-8-P2  Cin-Mir-8-P2-as  Cli-Mir-8-P2a  Cpi-Mir-8-P2a  Cpo-Mir-8-P2a  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P2a  Dpu-Mir-8  Dre-Mir-8-P2a  Ete-Mir-8-P2a  Gga-Mir-8-P2a  Hme-Mir-8  Hsa-Mir-8-P2a  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P2a  Mml-Mir-8-P2a  Mmu-Mir-8-P2a  Oan-Mir-8-P2a  Ocu-Mir-8-P2a  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P2a  Sha-Mir-8-P2a  Sko-Mir-8  Spu-Mir-8  Sto-Mir-8-P2a  Tgu-Mir-8-P2a  Xtr-Mir-8-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343647.1: 274657-274716 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P2a)
Mir-8-P2a GL343647.1: 274657-274716 [+] UCSC Ensembl
Mir-8-P1a GL343647.1: 276664-276724 [+] UCSC Ensembl
Mir-8-P3a GL343647.1: 283347-283406 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUGCUCAAACCAUCUUGGGAGGUCAUUGCCAUCUUACUGGGCAGCAUUGGAUGUUUUCUGUCUUUCUAAUACUGCCUGGUAAUGAUGAUUGUGGCCUUCUCACGCCCAGCAUGAAACGU
Get precursor sequence
Structure
        10          20        30         40        50         
CUUGCUCAAACCAUCUU--          UGC    -|   UG     C      UGUUUU 
                   GGGAGGUCAU   CAUC UUAC  GGCAG AUUGGA      \
                   UCUUCCGGUG   GUAG AAUG  CCGUC UAAUCU      C
UGCAAAGUACGACCCGCAC          UUA    U^   GU     A      UUCUGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-8-P2a_5p*

MirBase accessionMIMAT0021846
Sequence
0- CAUCUUACUGGGCAGCAUUGGA -22
Get sequence
Mature sequence

Aca-Mir-8-P2a_3p

MirBase accessionMIMAT0021847
Sequence
37- UAAUACUGCCUGGUAAUGAUGAU -60
Get sequence