MirGeneDB

MirGeneDB ID

Mmu-Mir-8-P2a

Family name MIR-8 (all species)
Seed AAUACUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-200b
Paralogues Mmu-Mir-8-P1a  Mmu-Mir-8-P1b  Mmu-Mir-8-P2b  Mmu-Mir-8-P3a 
Orthologues Aae-Mir-8  Aca-Mir-8-P2a  Ami-Mir-8-P2a  Asu-Mir-8  Bfl-Mir-8-P2-v1  Bfl-Mir-8-P2-v2  Bge-Mir-8  Bta-Mir-8-P2a  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P2a  Cgi-Mir-8  Cin-Mir-8-P2  Cin-Mir-8-P2-as  Cli-Mir-8-P2a  Cpi-Mir-8-P2a  Cpo-Mir-8-P2a  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P2a  Dpu-Mir-8  Dre-Mir-8-P2a  Ete-Mir-8-P2a  Gga-Mir-8-P2a  Hme-Mir-8  Hsa-Mir-8-P2a  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P2a  Mml-Mir-8-P2a  Oan-Mir-8-P2a  Ocu-Mir-8-P2a  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P2a  Sha-Mir-8-P2a  Sko-Mir-8  Spu-Mir-8  Sto-Mir-8-P2a  Tgu-Mir-8-P2a  Xtr-Mir-8-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr4: 156055684-156055742 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P2a)
Mir-8-P3a chr4: 156053916-156053974 [-] UCSC Ensembl
Mir-8-P1a chr4: 156054910-156054970 [-] UCSC Ensembl
Mir-8-P2a chr4: 156055684-156055742 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCUCCAUAUCCAACUUGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUAGUGUCUGAUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCAUGCAGCAAUGGAGCCG
Get precursor sequence
Structure
        10           20          30         40        50        
GCCUCCAUAUCCAACUU---    A--|    GGC    -    UG     C      UAGUG 
                    GGGC   GCCGU   CAUC UUAC  GGCAG AUUGGA     U
                    CCCG   CGGCA   GUAG AAUG  CCGUC UAAUCU     C
GCCGAGGUAACGACGUACGU    AGG^    ---    U    GU     A      CUAGU 
       110       100        90           80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-8-P2a_5p*

MirBase accessionMIMAT0004545
Sequence
0- CAUCUUACUGGGCAGCAUUGGA -22
Get sequence
Validated targets microrna.org: MIMAT0004545
TargetScanVert: mmu-miR-200b-5p
miRDB: MIMAT0004545
Mature sequence

Mmu-Mir-8-P2a_3p

MirBase accessionMIMAT0000233
Sequence
36- UAAUACUGCCUGGUAAUGAUGAC -59
Get sequence
Validated targets microrna.org: MIMAT0000233
TargetScanVert: mmu-miR-200b-3p
miRDB: MIMAT0000233