MirGeneDB

MirGeneDB ID

Rno-Mir-8-P3a

Family name MIR-8 (all species)
Seed AAUACUG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-429
Paralogues Rno-Mir-8-P1a  Rno-Mir-8-P1b  Rno-Mir-8-P2a  Rno-Mir-8-P2b 
Orthologues Aae-Mir-8  Aca-Mir-8-P3a  Ami-Mir-8-P3a  Asu-Mir-8  Bfl-Mir-8-P3  Bge-Mir-8  Bta-Mir-8-P3a  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P3a  Cgi-Mir-8  Cli-Mir-8-P3a  Cpi-Mir-8-P3a  Cpo-Mir-8-P3a  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P3a  Dpu-Mir-8  Dre-Mir-8-P3a  Ete-Mir-8-P3a  Gga-Mir-8-P3a  Hme-Mir-8  Hsa-Mir-8-P3a  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P3a  Mml-Mir-8-P3a  Mmu-Mir-8-P3a  Oan-Mir-8-P3a  Ocu-Mir-8-P3a  Pfl-Mir-8  Pmi-Mir-8  Sha-Mir-8-P3a  Sko-Mir-8  Spu-Mir-8  Sto-Mir-8-P3a  Xtr-Mir-8-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr5: 173488342-173488400 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P3a)
Mir-8-P3a chr5: 173488342-173488400 [-] UCSC Ensembl
Mir-8-P1a chr5: 173489379-173489439 [-] UCSC Ensembl
Mir-8-P2a chr5: 173490160-173490218 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUUGUACAAUGCACUGCCUGCUGAUGGAUGUCUUACCAGACAUGGUUAGAUCUGGAUGUAUCUGUCUAAUACUGUCUGGUAAUGCCGUCCAUCCAUGGCCUUAUCGCCGCCGGAGACG
Get precursor sequence
Structure
        10        20           30         40        50        
CCUUGUACAAUGCACUGCCU   ---       -| C          UG      UCUGGA 
                    GCU   GAUGGAU GU UUACCAGACA  GUUAGA      U
                    CGG   CUACCUG CG AAUGGUCUGU  UAAUCU      G
GCAGAGGCCGCCGCUAUUC-   UAC       C^ U          CA      GUCUAU 
       110        100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-8-P3a_5p*

MirBase accessionNone
Sequence
0- GUCUUACCAGACAUGGUUAGA -21
Get sequence
Mature sequence

Rno-Mir-8-P3a_3p

MirBase accessionMIMAT0001538
Sequence
37- UAAUACUGUCUGGUAAUGCCGU -59
Get sequence
Validated targets microrna.org: MIMAT0001538
TargetScanVert: rno-miR-429
miRDB: MIMAT0001538