MirGeneDB

MirGeneDB ID

Hsa-Mir-8-P1a

Family name MIR-8 (all species)
Seed AACACUG
Species Human (Homo sapiens)
MiRBase ID hsa-mir-200a
Paralogues Hsa-Mir-8-P1b  Hsa-Mir-8-P2a  Hsa-Mir-8-P2b  Hsa-Mir-8-P3a 
Orthologues Aae-Mir-8  Aca-Mir-8-P1a  Ami-Mir-8-P1a  Asu-Mir-8  Bfl-Mir-8-P1  Bge-Mir-8  Bta-Mir-8-P1a  Cbr-Mir-8  Cel-Mir-8  Cfa-Mir-8-P1a  Cgi-Mir-8  Cin-Mir-8-P1  Cli-Mir-8-P1a  Cpi-Mir-8-P1a  Cpo-Mir-8-P1a  Cte-Mir-8  Dan-Mir-8  Dme-Mir-8  Dmo-Mir-8  Dno-Mir-8-P1a  Dpu-Mir-8  Dre-Mir-8-P1a  Ete-Mir-8-P1a  Gga-Mir-8-P1a  Hme-Mir-8  Isc-Mir-8  Lan-Mir-8  Lgi-Mir-8  Mdo-Mir-8-P1a  Mml-Mir-8-P1a  Mmu-Mir-8-P1a  Oan-Mir-8-P1a  Ocu-Mir-8-P1a  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P1a  Sha-Mir-8-P1a  Sko-Mir-8  Spu-Mir-8  Sto-Mir-8-P1a  Tgu-Mir-8-P1a  Xtr-Mir-8-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr1: 1167878-1167938 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-8-P1a)
Mir-8-P2a chr1: 1167124-1167182 [+] UCSC Ensembl
Mir-8-P1a chr1: 1167878-1167938 [+] UCSC Ensembl
Mir-8-P3a chr1: 1169020-1169076 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACCCCACGUCCCUCCCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCCGCCGCUCGCCGGGGACAC
Get precursor sequence
Structure
        10         20         30         40        50         
GACCCCACGUCCCUCCC-   CC-   G        -|            C    UUUCCC 
                  GGG   CCU UGAGCAUC UUACCGGACAGUG UGGA      A
                  CCC   GGA ACUUGUAG AAUGGUCUGUCAC AUCU      G
CACAGGGGCCGCUCGCCG   AGU   A        C^            A    CAGUUC 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-8-P1a_5p*

MirBase accessionMIMAT0001620
Sequence
0- CAUCUUACCGGACAGUGCUGGA -22
Get sequence
Validated targets microrna.org: MIMAT0001620
TargetScanVert: hsa-miR-200a-5p
TargetMiner: hsa-miR-200a-5p
miRDB: MIMAT0001620
Mature sequence

Hsa-Mir-8-P1a_3p

MirBase accessionMIMAT0000682
Sequence
38- UAACACUGUCUGGUAACGAUGUU -61
Get sequence
Validated targets microrna.org: MIMAT0000682
TargetScanVert: hsa-miR-200a-3p
TargetMiner: hsa-miR-200a-3p
miRDB: MIMAT0000682