
MirGeneDB ID


Family name MIR-124 (all species)
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-124
Orthologues Aae-Mir-124  Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Aca-Mir-124-P3-v1  Aca-Mir-124-P3-v2  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Ami-Mir-124-P3-v1  Ami-Mir-124-P3-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P1-v1  Bta-Mir-124-P1-v2  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Bta-Mir-124-P3-v1  Bta-Mir-124-P3-v2  Cbr-Mir-124-P14  Cbr-Mir-124-P15  Cbr-Mir-124-P16  Cel-Mir-124  Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cfa-Mir-124-P3-v1  Cfa-Mir-124-P3-v2  Cgi-Mir-124-P12  Cgi-Mir-124-P13  Cin-Mir-124-P17  Cin-Mir-124-P18  Cli-Mir-124-P2-v1  Cli-Mir-124-P2-v2  Cli-Mir-124-P3-v1  Cli-Mir-124-P3-v2  Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpi-Mir-124-P3-v1  Cpi-Mir-124-P3-v2  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cpo-Mir-124-P1-v1  Cpo-Mir-124-P1-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cpo-Mir-124-P3-v1  Cpo-Mir-124-P3-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dno-Mir-124-P1-v1  Dno-Mir-124-P1-v2  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dno-Mir-124-P3-v1  Dno-Mir-124-P3-v2  Dpu-Mir-124  Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Dre-Mir-124-P3a-v1  Dre-Mir-124-P3a-v2  Dre-Mir-124-P3b-v1  Dre-Mir-124-P3b-v2  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Efe-Mir-124-P5  Efe-Mir-124-P6  Efe-Mir-124-P7  Efe-Mir-124-P8  Efe-Mir-124-P9  Ete-Mir-124-P1-v1  Ete-Mir-124-P1-v2  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Gga-Mir-124-P3-v1  Gga-Mir-124-P3-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Hsa-Mir-124-P2-v1  Hsa-Mir-124-P2-v2  Hsa-Mir-124-P3-v1  Hsa-Mir-124-P3-v2  Isc-Mir-124  Lan-Mir-124  Lgi-Mir-124-P10  Lgi-Mir-124-P11  Mdo-Mir-124-P1-v1  Mdo-Mir-124-P1-v2  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mdo-Mir-124-P3-v1  Mdo-Mir-124-P3-v2  Mml-Mir-124-P1-v1  Mml-Mir-124-P1-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mml-Mir-124-P3-v1  Mml-Mir-124-P3-v2  Mmu-Mir-124-P1-v1  Mmu-Mir-124-P1-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Mmu-Mir-124-P3-v1  Mmu-Mir-124-P3-v2  Oan-Mir-124-P2-v1  Oan-Mir-124-P2-v2  Oan-Mir-124-P3-v1  Oan-Mir-124-P3-v2  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Ocu-Mir-124-P1-v1  Ocu-Mir-124-P1-v2  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Ocu-Mir-124-P3-v1  Ocu-Mir-124-P3-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Rno-Mir-124-P2-v1  Rno-Mir-124-P2-v2  Rno-Mir-124-P3-v1  Rno-Mir-124-P3-v2  Sha-Mir-124-P1-v1  Sha-Mir-124-P1-v2  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sha-Mir-124-P3-v1  Sha-Mir-124-P3-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Sto-Mir-124-P3-v1  Sto-Mir-124-P3-v2  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124  Tgu-Mir-124-P1-v1  Tgu-Mir-124-P1-v2  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Tgu-Mir-124-P3-v1  Tgu-Mir-124-P3-v2  Xtr-Mir-124-P1-v1  Xtr-Mir-124-P1-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2  Xtr-Mir-124-P3-v1  Xtr-Mir-124-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
scaffold_6500: 21419509-21419564 [+] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50        
GAGUGACGUCGUUUGGUA---|    UU   C      C      AG    C    AAUU 
                     CGUUU  CUC UGGUAU CACUGU  GCCU UAUG    \
                     GCAAG  GAG ACCGUA GUGGCG  CGGA AUAC    U
AACAACCUAAAACAUCUCAAA^    C-   A      A      CA    -    CAGU 
    110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
Em Fe Ma Ma
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionMIMAT0008688
Get sequence