MirGeneDB

MirGeneDB ID

Ami-Mir-124-P4-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-124-4
Paralogues Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Ami-Mir-124-P3-v1  Ami-Mir-124-P3-v2  Ami-Mir-124-P4-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(allMis1)
JH732681: 531544-531602 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-124-P4-v1)
Mir-124-P4-v1 JH732681: 531544-531602 [-] UCSC
Mir-124-P4-v2 JH732681: 531545-531602 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GGGACCCUCCGGACCGCGGCCUCGGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCACACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGGGGCCGCCCUGCACCGCCCGGGGCA
Get precursor sequence
Structure
        10           20        30        40        50         
GGGACCCUCCGGACCGC---|     GG    CC        A   GA       UUAAUG 
                    GGCCUC  CUCU  GUGUUCAC GCG  CCUUGAU      \
                    CCGGGG  GAGA  CGUAAGUG CGC  GGAAUUA      U
ACGGGGCCCGCCACGUCCCG^     A-    AC        G   AC       ACACAC 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ami-Mir-124-P4-v1_5p*

MirBase accessionMIMAT0038125
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Mature sequence

Ami-Mir-124-P4-v1_3p

MirBase accessionMIMAT0038126
Sequence
37- UAAGGCACGCGGUGAAUGCCAA -59
Get sequence