MirGeneDB

MirGeneDB ID

Dan-Mir-124

Family name MIR-124 (all species)
Seed AAGGCAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-124
Paralogues
Orthologues Aae-Mir-124  Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Aca-Mir-124-P3-v1  Aca-Mir-124-P3-v2  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Ami-Mir-124-P3-v1  Ami-Mir-124-P3-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P1-v1  Bta-Mir-124-P1-v2  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Bta-Mir-124-P3-v1  Bta-Mir-124-P3-v2  Cbr-Mir-124-P14  Cbr-Mir-124-P15  Cbr-Mir-124-P16  Cel-Mir-124  Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cfa-Mir-124-P3-v1  Cfa-Mir-124-P3-v2  Cgi-Mir-124-P12  Cgi-Mir-124-P13  Cin-Mir-124-P17  Cin-Mir-124-P18  Cli-Mir-124-P2-v1  Cli-Mir-124-P2-v2  Cli-Mir-124-P3-v1  Cli-Mir-124-P3-v2  Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpi-Mir-124-P3-v1  Cpi-Mir-124-P3-v2  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cpo-Mir-124-P1-v1  Cpo-Mir-124-P1-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cpo-Mir-124-P3-v1  Cpo-Mir-124-P3-v2  Cte-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P1-v1  Dno-Mir-124-P1-v2  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dno-Mir-124-P3-v1  Dno-Mir-124-P3-v2  Dpu-Mir-124  Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Dre-Mir-124-P3a-v1  Dre-Mir-124-P3a-v2  Dre-Mir-124-P3b-v1  Dre-Mir-124-P3b-v2  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Efe-Mir-124-P5  Efe-Mir-124-P6  Efe-Mir-124-P7  Efe-Mir-124-P8  Efe-Mir-124-P9  Ete-Mir-124-P1-v1  Ete-Mir-124-P1-v2  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Gga-Mir-124-P3-v1  Gga-Mir-124-P3-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Hsa-Mir-124-P2-v1  Hsa-Mir-124-P2-v2  Hsa-Mir-124-P3-v1  Hsa-Mir-124-P3-v2  Isc-Mir-124  Lan-Mir-124  Lgi-Mir-124-P10  Lgi-Mir-124-P11  Mdo-Mir-124-P1-v1  Mdo-Mir-124-P1-v2  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mdo-Mir-124-P3-v1  Mdo-Mir-124-P3-v2  Mml-Mir-124-P1-v1  Mml-Mir-124-P1-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mml-Mir-124-P3-v1  Mml-Mir-124-P3-v2  Mmu-Mir-124-P1-v1  Mmu-Mir-124-P1-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Mmu-Mir-124-P3-v1  Mmu-Mir-124-P3-v2  Oan-Mir-124-P2-v1  Oan-Mir-124-P2-v2  Oan-Mir-124-P3-v1  Oan-Mir-124-P3-v2  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Ocu-Mir-124-P1-v1  Ocu-Mir-124-P1-v2  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Ocu-Mir-124-P3-v1  Ocu-Mir-124-P3-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Rno-Mir-124-P2-v1  Rno-Mir-124-P2-v2  Rno-Mir-124-P3-v1  Rno-Mir-124-P3-v2  Sha-Mir-124-P1-v1  Sha-Mir-124-P1-v2  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sha-Mir-124-P3-v1  Sha-Mir-124-P3-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Sto-Mir-124-P3-v1  Sto-Mir-124-P3-v2  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124  Tgu-Mir-124-P1-v1  Tgu-Mir-124-P1-v2  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Tgu-Mir-124-P3-v1  Tgu-Mir-124-P3-v2  Xtr-Mir-124-P1-v1  Xtr-Mir-124-P1-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2  Xtr-Mir-124-P3-v1  Xtr-Mir-124-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12916: 3309714-3309769 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUUUUGUGUCGUUUGGUACGUUUUUCUCCUGGUAUCCACUGUAGGCCUAUAUGUAUUUCGACCAUAAGGCACGCGGUGAAUGCCAAGAGCGAACGAAACUCUACAAACUACAAAUG
Get precursor sequence
Structure
        10           20        30        40        50        
CUUUUGUGUCGUUUGGUA---|    UU   C      C      AG    A    UAUU 
                     CGUUU  CUC UGGUAU CACUGU  GCCU UAUG    \
                     GCAAG  GAG ACCGUA GUGGCG  CGGA AUAC    U
GUAAACAUCAAACAUCUCAAA^    C-   A      A      CA    -    CAGC 
    110       100        90         80        70         60
Deep sequencing
Go to detailed chart
CommentThere are Drosha sites -1 and -2 relative to what is shown here.
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-124_5p*

MirBase accessionNone
Sequence
0- GGUAUCCACUGUAGGCCUAUAUG -23
Get sequence
Mature sequence

Dan-Mir-124_3p

MirBase accessionMIMAT0008431
Sequence
34- UAAGGCACGCGGUGAAUGCCAA -56
Get sequence