MirGeneDB

MirGeneDB ID

Cpi-Mir-124-P4-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-124-4
Paralogues Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpi-Mir-124-P3-v1  Cpi-Mir-124-P3-v2  Cpi-Mir-124-P4-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(chrPic1)
JH584506: 1072250-1072308 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-124-P4-v1)
Mir-124-P4-v1 JH584506: 1072250-1072308 [+] UCSC
Mir-124-P4-v2 JH584506: 1072250-1072307 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CGGUUCCUUCGCCGCUCGGCUUCCGCUUUUCGUGUUCACAGCGGACCUUGAUUUAAUUUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGAAGCCGGACUCGUACGCCUCUCCCC
Get precursor sequence
Structure
        10           20        30        40        50         
CGGUUCCUUCGCCGCUC---|     CG     C        A   GA       UUAAUU 
                    GGCUUC  CUUUU GUGUUCAC GCG  CCUUGAU      \
                    CCGAAG  GAGAA CGUAAGUG CGC  GGAAUUA      U
CCCCUCUCCGCAUGCUCAGG^     A-     C        G   AC       ACAUAC 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-124-P4-v1_5p*

MirBase accessionMIMAT0037726
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Mature sequence

Cpi-Mir-124-P4-v1_3p

MirBase accessionMIMAT0037727
Sequence
37- UAAGGCACGCGGUGAAUGCCAA -59
Get sequence