MirGeneDB

MirGeneDB ID

Cte-Mir-124

Family name MIR-124 (all species)
Seed AAGGCAC
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-124
Paralogues
Orthologues Aae-Mir-124  Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Aca-Mir-124-P3-v1  Aca-Mir-124-P3-v2  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Ami-Mir-124-P3-v1  Ami-Mir-124-P3-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P1-v1  Bta-Mir-124-P1-v2  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Bta-Mir-124-P3-v1  Bta-Mir-124-P3-v2  Cbr-Mir-124-P14  Cbr-Mir-124-P15  Cbr-Mir-124-P16  Cel-Mir-124  Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cfa-Mir-124-P3-v1  Cfa-Mir-124-P3-v2  Cgi-Mir-124-P12  Cgi-Mir-124-P13  Cin-Mir-124-P17  Cin-Mir-124-P18  Cli-Mir-124-P2-v1  Cli-Mir-124-P2-v2  Cli-Mir-124-P3-v1  Cli-Mir-124-P3-v2  Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpi-Mir-124-P3-v1  Cpi-Mir-124-P3-v2  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cpo-Mir-124-P1-v1  Cpo-Mir-124-P1-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cpo-Mir-124-P3-v1  Cpo-Mir-124-P3-v2  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P1-v1  Dno-Mir-124-P1-v2  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dno-Mir-124-P3-v1  Dno-Mir-124-P3-v2  Dpu-Mir-124  Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Dre-Mir-124-P3a-v1  Dre-Mir-124-P3a-v2  Dre-Mir-124-P3b-v1  Dre-Mir-124-P3b-v2  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Efe-Mir-124-P5  Efe-Mir-124-P6  Efe-Mir-124-P7  Efe-Mir-124-P8  Efe-Mir-124-P9  Ete-Mir-124-P1-v1  Ete-Mir-124-P1-v2  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Gga-Mir-124-P3-v1  Gga-Mir-124-P3-v2  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Hsa-Mir-124-P2-v1  Hsa-Mir-124-P2-v2  Hsa-Mir-124-P3-v1  Hsa-Mir-124-P3-v2  Isc-Mir-124  Lan-Mir-124  Lgi-Mir-124-P10  Lgi-Mir-124-P11  Mdo-Mir-124-P1-v1  Mdo-Mir-124-P1-v2  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mdo-Mir-124-P3-v1  Mdo-Mir-124-P3-v2  Mml-Mir-124-P1-v1  Mml-Mir-124-P1-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mml-Mir-124-P3-v1  Mml-Mir-124-P3-v2  Mmu-Mir-124-P1-v1  Mmu-Mir-124-P1-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Mmu-Mir-124-P3-v1  Mmu-Mir-124-P3-v2  Oan-Mir-124-P2-v1  Oan-Mir-124-P2-v2  Oan-Mir-124-P3-v1  Oan-Mir-124-P3-v2  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Ocu-Mir-124-P1-v1  Ocu-Mir-124-P1-v2  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Ocu-Mir-124-P3-v1  Ocu-Mir-124-P3-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Rno-Mir-124-P2-v1  Rno-Mir-124-P2-v2  Rno-Mir-124-P3-v1  Rno-Mir-124-P3-v2  Sha-Mir-124-P1-v1  Sha-Mir-124-P1-v2  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sha-Mir-124-P3-v1  Sha-Mir-124-P3-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Sto-Mir-124-P3-v1  Sto-Mir-124-P3-v2  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124  Tgu-Mir-124-P1-v1  Tgu-Mir-124-P1-v2  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Tgu-Mir-124-P3-v1  Tgu-Mir-124-P3-v2  Xtr-Mir-124-P1-v1  Xtr-Mir-124-P1-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2  Xtr-Mir-124-P3-v1  Xtr-Mir-124-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_156: 154734-154791 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAGAGGACGUUGUUCUGGCGACUUCUUGGCGUUCACGGCGUGGUCCUUGGUGUGACUACAACAAUUAAGGCACGCGGUGAAUGCCAAGACGACCGCCGCUGCCUCCUGAGACGUAA
Get precursor sequence
Structure
        10         20         30        40        50         
UGCAGAGGACGUUGUUCU-    ACU-|            G     GU       GUGAC 
                   GGCG    UCUUGGCGUUCAC GCGUG  CCUUGGU     U
                   CCGC    AGAACCGUAAGUG CGCAC  GGAAUUA     A
AAUGCAGAGUCCUCCGUCG    CAGC^            G     --       ACAAC 
      110       100        90        80          70        60
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Cte-Mir-124_5p* (predicted)

MirBase accessionNone
Sequence
0- GCGUUCACGGCGUGGUCCUUGGU -23
Get sequence
Mature sequence

Cte-Mir-124_3p (predicted)

MirBase accessionMIMAT0009555
Sequence
37- UAAGGCACGCGGUGAAUGCCA -58
Get sequence