MirGeneDB

MirGeneDB ID

Ete-Mir-124-P1-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-124-P1-v2  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P1-v1  Bta-Mir-124-P1-v2  Cel-Mir-124  Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpo-Mir-124-P1-v1  Cpo-Mir-124-P1-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P1-v1  Dno-Mir-124-P1-v2  Dpu-Mir-124  Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Hme-Mir-124  Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P1-v1  Mdo-Mir-124-P1-v2  Mml-Mir-124-P1-v1  Mml-Mir-124-P1-v2  Mmu-Mir-124-P1-v1  Mmu-Mir-124-P1-v2  Ocu-Mir-124-P1-v1  Ocu-Mir-124-P1-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Sha-Mir-124-P1-v1  Sha-Mir-124-P1-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Tca-Mir-124  Tgu-Mir-124-P1-v1  Tgu-Mir-124-P1-v2  Xtr-Mir-124-P1-v1  Xtr-Mir-124-P1-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(echTel2)
JH980320: 18619090-18619150 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UUCCUUCGCCAGGAGAAAGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUGGCUGAGCACCGUCGGUCCG
Get precursor sequence
Structure
        10          20        30        40        50          
UUCCUUCGCCAGGAGAAA--|     UC   CC        A   GA       UUAAAUG 
                    GGCCUC  UCU  GUGUUCAC GCG  CCUUGAU       \
                    UCGGGG  AGA  CGUAAGUG CGC  GGAAUUA       U
GCCUGGCUGCCACGAGUCGG^     UA   AC        G   AC       ACAUACC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ete-Mir-124-P1-v1_5p*

MirBase accessionNone
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Mature sequence

Ete-Mir-124-P1-v1_3p

MirBase accessionNone
Sequence
39- UAAGGCACGCGGUGAAUGCCAA -61
Get sequence