MirGeneDB

MirGeneDB ID

Tgu-Mir-124-P1-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-124-2
Paralogues Tgu-Mir-124-P1-v2  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Tgu-Mir-124-P3-v1  Tgu-Mir-124-P3-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P1-v1  Aca-Mir-124-P1-v2  Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P1-v1  Bta-Mir-124-P1-v2  Cel-Mir-124  Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cpi-Mir-124-P1-v1  Cpi-Mir-124-P1-v2  Cpo-Mir-124-P1-v1  Cpo-Mir-124-P1-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P1-v1  Dno-Mir-124-P1-v2  Dpu-Mir-124  Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Ete-Mir-124-P1-v1  Ete-Mir-124-P1-v2  Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Hme-Mir-124  Hsa-Mir-124-P1-v1  Hsa-Mir-124-P1-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P1-v1  Mdo-Mir-124-P1-v2  Mml-Mir-124-P1-v1  Mml-Mir-124-P1-v2  Mmu-Mir-124-P1-v1  Mmu-Mir-124-P1-v2  Ocu-Mir-124-P1-v1  Ocu-Mir-124-P1-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Sha-Mir-124-P1-v1  Sha-Mir-124-P1-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P1-v1  Sto-Mir-124-P1-v2  Tca-Mir-124  Xtr-Mir-124-P1-v1  Xtr-Mir-124-P1-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
3: 111968091-111968151 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P1-v1)
Mir-124-P1-v1 3: 111968091-111968151 [+] UCSC Ensembl
Mir-124-P1-v2 3: 111968091-111968150 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
NNNNNNNNNNNNNNNNNNNNNNNNNCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAACGAGGCUGACCAGCAUCGAGGCCGGAG
Get precursor sequence
Structure
        10        20          30        40        50          
NNNNNNNNNNNNNNNNNNNNNNNNNC--|  CC        A   GA       UUAAAUG 
                            UCU  GUGUUCAC GCG  CCUUGAU       \
                            AGA  CGUAAGUG CGC  GGAAUUA       U
GAGGCCGGAGCUACGACCAGUCGGAGCA^  AC        G   AC       ACAUACC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-124-P1-v1_5p*

MirBase accessionMIMAT0014630
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Mature sequence

Tgu-Mir-124-P1-v1_3p

MirBase accessionMIMAT0014507
Sequence
39- UAAGGCACGCGGUGAAUGCCAA -61
Get sequence