MirGeneDB

MirGeneDB ID

Dre-Mir-124-P4-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-124-4
Paralogues Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Dre-Mir-124-P3a-v1  Dre-Mir-124-P3a-v2  Dre-Mir-124-P3b-v1  Dre-Mir-124-P3b-v2  Dre-Mir-124-P4-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Gga-Mir-124-P4-v1  Gga-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Oan-Mir-124-P4-v1  Oan-Mir-124-P4-v2  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P4-v1  Sto-Mir-124-P4-v2  Tca-Mir-124 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr17: 27402274-27402333 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P4-v1)
Mir-124-P4-v1 chr17: 27402274-27402333 [+] UCSC Ensembl
Mir-124-P4-v2 chr17: 27402274-27402332 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGACAUUCGGAAACUUGGGUUUUUGCUCUUUGUGUUCACAGUGGACCUUGAUUUAAUUUCAAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGAAGCCAACAGCAGCACUCACCUGAG
Get precursor sequence
Structure
        10           20        30        40        50         
UGACAUUCGGAAACUUG---|      G     U        A   GA       UUAAUU 
                    GGUUUUU CUCUU GUGUUCAC GUG  CCUUGAU      U
                    CCGAAGA GAGAA CGUAAGUG CGC  GGAAUUA      C
GAGUCCACUCACGACGACAA^      -     C        G   AC       ACAUAA 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-124-P4-v1_5p*

MirBase accessionMIMAT0031961
Sequence
0- UGUGUUCACAGUGGACCUUGAU -22
Get sequence
Mature sequence

Dre-Mir-124-P4-v1_3p

MirBase accessionMIMAT0001819
Sequence
38- UAAGGCACGCGGUGAAUGCCAA -60
Get sequence
Validated targets TargetScanFish: dre-miR-124