MirGeneDB

MirGeneDB ID

Rno-Mir-124-P2-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-124-2
Paralogues Rno-Mir-124-P1-v1  Rno-Mir-124-P1-v2  Rno-Mir-124-P2-v2  Rno-Mir-124-P3-v1  Rno-Mir-124-P3-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Cel-Mir-124  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cli-Mir-124-P2-v1  Cli-Mir-124-P2-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dpu-Mir-124  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Hme-Mir-124  Hsa-Mir-124-P2-v1  Hsa-Mir-124-P2-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Oan-Mir-124-P2-v1  Oan-Mir-124-P2-v2  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Pfl-Mir-124  Pmi-Mir-124  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Tca-Mir-124  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr2: 102311627-102311685 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P2-v1)
Mir-124-P2-v1 chr2: 102311627-102311685 [+] UCSC Ensembl
Mir-124-P2-v2 chr2: 102311627-102311684 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCUAGAUCAAGAUCAGAGACUCUGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGCGGAGCCUACGGCUGCACUUGAAGGAC
Get precursor sequence
Structure
        10          20        30        40        50         
UUCUAGAUCAAGAUCAG--| A         CC        A   GA       UUAAUG 
                   AG CUCUGCUCU  GUGUUCAC GCG  CCUUGAU      \
                   UC GAGGCGAGA  CGUAAGUG CGC  GGAAUUA      U
CAGGAAGUUCACGUCGGCA^ C         AC        G   AC       ACAUAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-124-P2-v1_5p*

MirBase accessionMIMAT0004728
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Validated targets microrna.org: MIMAT0004728
TargetScanVert: rno-miR-124-5p
miRDB: MIMAT0004728
Mature sequence

Rno-Mir-124-P2-v1_3p

MirBase accessionMIMAT0000828
Sequence
37- UAAGGCACGCGGUGAAUGCCAA -59
Get sequence
Validated targets microrna.org: MIMAT0000828
TargetScanVert: rno-miR-124-3p
miRDB: MIMAT0000828