MirGeneDB

MirGeneDB ID

Cfa-Mir-124-P3-v1

Family name MIR-124 (all species)
Seed AAGGCAC
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-124-3
Paralogues Cfa-Mir-124-P1-v1  Cfa-Mir-124-P1-v2  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cfa-Mir-124-P3-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P3-v1  Aca-Mir-124-P3-v2  Ami-Mir-124-P3-v1  Ami-Mir-124-P3-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P3-v1  Bta-Mir-124-P3-v2  Cel-Mir-124  Cli-Mir-124-P3-v1  Cli-Mir-124-P3-v2  Cpi-Mir-124-P3-v1  Cpi-Mir-124-P3-v2  Cpo-Mir-124-P3-v1  Cpo-Mir-124-P3-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P3-v1  Dno-Mir-124-P3-v2  Dpu-Mir-124  Dre-Mir-124-P3a-v1  Dre-Mir-124-P3a-v2  Dre-Mir-124-P3b-v1  Dre-Mir-124-P3b-v2  Gga-Mir-124-P3-v1  Gga-Mir-124-P3-v2  Hme-Mir-124  Hsa-Mir-124-P3-v1  Hsa-Mir-124-P3-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P3-v1  Mdo-Mir-124-P3-v2  Mml-Mir-124-P3-v1  Mml-Mir-124-P3-v2  Mmu-Mir-124-P3-v1  Mmu-Mir-124-P3-v2  Oan-Mir-124-P3-v1  Oan-Mir-124-P3-v2  Ocu-Mir-124-P3-v1  Ocu-Mir-124-P3-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P3-v1  Rno-Mir-124-P3-v2  Sha-Mir-124-P3-v1  Sha-Mir-124-P3-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P3-v1  Sto-Mir-124-P3-v2  Tca-Mir-124  Tgu-Mir-124-P3-v1  Tgu-Mir-124-P3-v2  Xtr-Mir-124-P3-v1  Xtr-Mir-124-P3-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(canFam3)
chr24: 46916731-46916790 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P3-v1)
Mir-124-P3-v1 chr24: 46916731-46916790 [+] UCSC Ensembl
Mir-124-P3-v2 chr24: 46916731-46916789 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGCGCCCCGCUGCCUGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCCGCCGCUCCUUUCUCAUG
Get precursor sequence
Structure
        10         20          30        40        50         
CCCGCGCCCCGCUGCCU-    -   C   -| C        A   GA       UUAAUG 
                  GAGG GCC CUC UG GUGUUCAC GCG  CCUUGAU      U
                  CUCC CGG GAG AC CGUAAGUG CGC  GGAAUUA      C
GUACUCUUUCCUCGCCGC    G   A   A^ -        G   AC       ACAUAC 
.       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Star sequence

Cfa-Mir-124-P3-v1_5p*

MirBase accessionNone
Sequence
0- CGUGUUCACAGCGGACCUUGAU -22
Get sequence
Mature sequence

Cfa-Mir-124-P3-v1_3p

MirBase accessionMIMAT0006657
Sequence
38- UAAGGCACGCGGUGAAUGCCAA -60
Get sequence
Validated targets TargetScanVert: cfa-miR-124
miRDB: MIMAT0006657