MirGeneDB

MirGeneDB ID

Dan-Mir-216-P2

Family name MIR-216 (all species)
Seed AAUAUCA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-283
Paralogues Dan-Mir-216-P1 
Orthologues Aae-Mir-216-P2  Asu-Mir-216-P2  Bge-Mir-216-P2  Cgi-Mir-216-P2  Cte-Mir-216-P2  Dme-Mir-216-P2  Dmo-Mir-216-P2  Dpu-Mir-216-P2  Efe-Mir-216-P2a  Efe-Mir-216-P2b  Hme-Mir-216-P2  Lan-Mir-216-P2a  Lan-Mir-216-P2b  Lgi-Mir-216-P2  Tca-Mir-216-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12929: 2900402-2900470 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P2)
Mir-12 scaffold_12929: 2898590-2898653 [-] Ensembl
Mir-216-P1 scaffold_12929: 2899119-2899186 [-] Ensembl
Mir-216-P2 scaffold_12929: 2900402-2900470 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUCACCACCUCACCUGAUUCUUAAAGGUAAAUAUCAGCUGGUAAUUCUGGGAGCUAUGCCUGAUUAUGAAACACUCGGAAUUUCAGUUGGUAUCGACUUUUUCGAAUUGCAUUUUAUCACCAAAAAC
Get precursor sequence
Structure
        10          20        30        40        50        60    
UGUUCACCACCUCACCU--|    UU      AA           U         AGCUAUGCCU 
                   GAUUC  AAAGGU  AUAUCAGCUGG AAUUCUGGG          G
                   UUAAG  UUUUCA  UAUGGUUGACU UUAAGGCUC          A
CAAAAACCACUAUUUUACG^    CU      GC           -         ACAAAGUAUU 
       120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-216-P2_5p

MirBase accessionMIMAT0008437
Sequence
0- AAAUAUCAGCUGGUAAUUCUGGG -23
Get sequence
Star sequence

Dan-Mir-216-P2_3p*

MirBase accessionNone
Sequence
47- CGGAAUUUCAGUUGGUAUCGAC -69
Get sequence