MirGeneDB 2.1
MirGeneDB ID

Rno-Mir-216-P2b

Family name MIR-216 (all species)
Seed AAUCUCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-216a
Paralogues Rno-Mir-216-P2a 
Orthologues Aae-Mir-216-P2  Aca-Mir-216-P2b  Ami-Mir-216-P2b  Asu-Mir-216-P2  Bfl-Mir-216-P2  Bge-Mir-216-P2  Bla-Mir-216-P2  Bpl-Mir-216-P2  Bta-Mir-216-P2b  Cbr-Mir-216-P2  Cel-Mir-216-P2  Cfa-Mir-216-P2b  Cgi-Mir-216-P2  Cli-Mir-216-P2b  Cmi-Mir-216-P2b  Cpi-Mir-216-P2b  Cpo-Mir-216-P2b  Dan-Mir-216-P2  Dma-Mir-216-P2  Dme-Mir-216-P2  Dmo-Mir-216-P2  Dno-Mir-216-P2b  Dpu-Mir-216-P2  Dre-Mir-216-P2b  Dsi-Mir-216-P2  Dya-Mir-216-P2  Ebu-Mir-216-P2b1  Efe-Mir-216-P2  Ete-Mir-216-P2b  Gga-Mir-216-P2b  Gja-Mir-216-P2b  Gmo-Mir-216-P2b  Hme-Mir-216-P2  Hsa-Mir-216-P2b  Isc-Mir-216-P2  Lch-Mir-216-P2b  Lgi-Mir-216-P2  Loc-Mir-216-P2b  Mal-Mir-216-P2b  Mdo-Mir-216-P2b  Mml-Mir-216-P2b  Mmu-Mir-216-P2b  Mun-Mir-216-P2b  Oan-Mir-216-P2b  Ocu-Mir-216-P2b  Pbv-Mir-216-P2b  Pma-Mir-216-P2b1  Sha-Mir-216-P2b  Spt-Mir-216-P2b  Sto-Mir-216-P2b  Tca-Mir-216-P2  Tgu-Mir-216-P2b  Tni-Mir-216-P2b  Xla-Mir-216-P2b3  Xla-Mir-216-P2b4  Xtr-Mir-216-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)		 chr14: 113112147-113112208 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-216-P2b)		 Mir-216-P2a chr14: 113101097-113101158 [+] UCSC Ensembl
Mir-216-P2b chr14: 113112147-113112208 [+] UCSC Ensembl
Mir-217-v2 chr14: 113119559-113119619 [+] UCSC Ensembl
Mir-217-v1 chr14: 113119560-113119618 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGUCCAACCUGGUUAGCUAUGAGUUAGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGACCUCCUGG
Get precursor sequence
Structure
        10           20        30        40        50        60 
AGGUCCAACCUGGUUAG---| A  AG     U         CU   A        AUGUCCC 
                    CU UG  UUAGU UAAUCUCAG  GGC ACUGUGAG       \
                    GA AC  AAUCG AUUAGGGUC  CUG UGACACUC       U
GGUCCUCCAGUUCCUUUAAC^ G  A-     U         U-   G        CUUACUA 
120       110       100         90         80        70
Deep sequencing
Go to detailed chart
CommentThis gene was named Mir-216-P2 in MirGene 1.0 but it appears that there are two ancestral copies of Mir-216 with the second copy found only in protostomes and the two copies in vertebrates a vertebrate-specific gene duplication of one of these two ancestral paralogues.
3' NTU No
MotifsNo
Tissue expression
-   +
Ad Ad Br Br Br Ce Ce Ce Ce Co Co Co Co Dr Dr Du Du Du Du He He Hi Hi Il Il Je Je Ki Ki Ki Ki Li Li Li Li Me Me Mu Mu Mu Mu Mu Mu Mu Mu Ov Pa Pa St St St Te Ut Wh Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-216-P2b_5p
mirBase accessionMIMAT0000886
Sequence 
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Proposed targets microrna.org: MIMAT0000886
TargetScanVert: rno-miR-216a-5p
miRDB: MIMAT0000886
Star sequence

Rno-Mir-216-P2b_3p*
mirBase accessionMIMAT0017160
Sequence 
40- CACAGUGGUCUCUGGGAUUAUG -62
Get sequence
Proposed targets TargetScanVert: rno-miR-216a-3p
miRDB: MIMAT0017160