MirGeneDB

MirGeneDB ID

Bge-Mir-219

Family name MIR-219 (all species)
Seed GGACUGU
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Aca-Mir-219-P2  Ami-Mir-219-P1  Ami-Mir-219-P2  Bfl-Mir-219  Bta-Mir-219-P1  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P1  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P1  Cpi-Mir-219-P2  Cpo-Mir-219-P1  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P1a  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Efe-Mir-219-P3  Efe-Mir-219-P4  Efe-Mir-219-P5  Ete-Mir-219-P1  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P1  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mdo-Mir-219-P2  Mml-Mir-219-P1  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P1  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P1  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Bger_2.0)
KZ614940.1: 254374-254433 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UGGAAGAAGAGAAAAGCGAGUUUCAGGCUGUGAUUGUCCAAACGCAAUUCUUGUGGUUAGUCUAGUCAAGGACUGUGUGUGGACAUCAAUGCUUGGAACGUAACACCAGCUCCAACCAAC
Get precursor sequence
Structure
        10          20        30        40        50          
UGGAAGAAGAGAAAAGCGA--|        UG    U     A     A      UGGUUA 
                     GUUUCAGGC  UGAU GUCCA ACGCA UUCUUG      \
                     CAAGGUUCG  ACUA CAGGU UGUGU AGGAAC      G
CAACCAACCUCGACCACAAUG^        UA    -     G     C      UGAUCU 
.       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-219_5p*

MirBase accessionNone
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Mature sequence

Bge-Mir-219_3p

MirBase accessionNone
Sequence
38- AGGACUGUGUGUGGACAUCAAU -60
Get sequence