MirGeneDB

MirGeneDB ID

Aca-Mir-219-P2

Family name MIR-219 (all species)
Seed GAUUGUC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-219-1
Paralogues Aca-Mir-219-P1 
Orthologues Aae-Mir-219  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL344072.1: 36997-37061 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAUCCAGGUCCAGAAGGAACCUUUGCUCCUGAUUGUCCAAACGCAAUUCUUGUCCAGAAAACAUGCAAACCAAGAAUUGUGUCUGGACAUCUGUGGCCAAGUCUUCAAGCGCGGCAAGAGAGGC
Get precursor sequence
Structure
        10         20         30        40        50        60  
CCAUCCAGGUCCAGAAG-   C-|  U   CCU   U     A            UCCAGAAA 
                  GAA  CUU GCU   GAU GUCCA ACGCAAUUCUUG        A
                  CUU  GAA CGG   CUA CAGGU UGUGUUAAGAAC        C
CGGAGAGAACGGCGCGAA   CU^  C   UGU   -     C            CAAACGUA 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-219-P2_5p

MirBase accessionMIMAT0021884
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Star sequence

Aca-Mir-219-P2_3p*

MirBase accessionMIMAT0021885
Sequence
43- AGAAUUGUGUCUGGACAUCUGU -65
Get sequence