MirGeneDB

MirGeneDB ID

Spu-Mir-219

Family name MIR-219 (all species)
Seed GAACUGU
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-219
Paralogues
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Aca-Mir-219-P2  Ami-Mir-219-P1  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P1  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P1  Cpi-Mir-219-P2  Cpo-Mir-219-P1  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P1a  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Efe-Mir-219-P3  Efe-Mir-219-P4  Efe-Mir-219-P5  Ete-Mir-219-P1  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P1  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mdo-Mir-219-P2  Mml-Mir-219-P1  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P1  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P1  Sha-Mir-219-P2  Sko-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold392: 474637-474697 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAUCGUAUUUUCCAUGCGAGUGUUCUCCGUUGAUUGUCCGAACGCAAUUCUUGUUGAAUUUCCUAGUCAAGAACUGUGUACGGACAUCAGUGGUUGAUACCGCUAGCACCUAGAUCAUCAG
Get precursor sequence
Structure
        10           20        30        40        50        60
CAUCGUAUUUUCCAUGC---|A     CU        U     A     A      UUGAAU 
                    G GUGUU  CCGUUGAU GUCCG ACGCA UUCUUG      U
                    C CAUAG  GGUGACUA CAGGC UGUGU AAGAAC      U
GACUACUAGAUCCACGAUCG^-     UU        -     A     C      UGAUCC 
 .       110        100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-219_5p*

MirBase accessionMIMAT0009685
Sequence
0- UGAUUGUCCGAACGCAAUUCUUG -23
Get sequence
Mature sequence

Spu-Mir-219_3p

MirBase accessionMIMAT0022953
Sequence
39- AGAACUGUGUACGGACAUCAGU -61
Get sequence