MirGeneDB

MirGeneDB ID

Dre-Mir-219-P2a

Family name MIR-219 (all species)
Seed GAUUGUC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-219-1
Paralogues Dre-Mir-219-P1a  Dre-Mir-219-P2b 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr10: 10329476-10329540 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAUUAUCCUUUUGAAAGGGUCCCAGAGAUUGAUUGUCCAAACGCAAUUCUUGUAACAUAUAAUAUAAAUCCAAGAAUUGUGCCUGGACAUCUGUUGCUGGAGAUUCAACAUCAUCUUUCUGGAG
Get precursor sequence
Structure
        10         20         30        40        50        60  
AAAUUAUCCUUUUGAAA-     -|   AG  U   U     AA           UAACAUAU 
                  GGGUC CCAG  AU GAU GUCCA  CGCAAUUCUUG        A
                  CUUAG GGUC  UG CUA CAGGU  GUGUUAAGAAC        A
GAGGUCUUUCUACUACAA     A^   GU  U   -     CC           CUAAAUAU 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-219-P2a_5p

MirBase accessionMIMAT0001286
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Validated targets TargetScanFish: dre-miR-219
Star sequence

Dre-Mir-219-P2a_3p*

MirBase accessionNone
Sequence
43- AGAAUUGUGCCUGGACAUCUGU -65
Get sequence