MirGeneDB

MirGeneDB ID

Dre-Mir-219-P2b

Family name MIR-219 (all species)
Seed GAUUGUC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-219-2
Paralogues Dre-Mir-219-P1a  Dre-Mir-219-P2a 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr5: 65101371-65101437 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUUUUGUGGAAAUUUGAGCUCAAGCAGUUGAUUGUCCAAACGCAAUUCUUGUGAAAUGUCGAGCGAUCAGUCGAGAAUUGUGCCUGGACAUCUGUUGCUGGAGGCUCCACGCGACUCAUCAUCAU
Get precursor sequence
Structure
        10         20         30        40        50        60   
UUUUUUUGUGGAAAUUU-   -|  A     UU   U     AA           UGAAAUGUC 
                  GAG CUC AGCAG  GAU GUCCA  CGCAAUUCUUG         G
                  CUC GAG UCGUU  CUA CAGGU  GUGUUAAGAGC         A
UACUACUACUCAGCGCAC   G^  G     GU   -     CC           UGACUAGCG 
     120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-219-P2b_5p

MirBase accessionMIMAT0001286
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Validated targets TargetScanFish: dre-miR-219
Star sequence

Dre-Mir-219-P2b_3p*

MirBase accessionNone
Sequence
45- AGAAUUGUGCCUGGACAUCUGU -67
Get sequence