MirGeneDB

MirGeneDB ID

Ami-Mir-219-P2

Family name MIR-219 (all species)
Seed GAAUUGU
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-219b
Paralogues Ami-Mir-219-P1 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(allMis1)
JH735267: 383342-383408 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GCGAGCCCGGCCCGCGGGAGUCUCCGCUCCUGAUUGUCCAAACGCAAUUCUUGUGCCGUGGAAACGUACAAACCAAGAAUUGUGUCUGGACAUCUGUGGCGGGGAGUCCGACCUCGUCACCGGGCCC
Get precursor sequence
Structure
        10          20        30        40        50        60   
GCGAGCCCGGCCCGCGG--| G        CCU   U     A            UGCCGUGGA 
                   GA UCUCCGCU   GAU GUCCA ACGCAAUUCUUG         A
                   CU AGGGGCGG   CUA CAGGU UGUGUUAAGAAC         A
CCCGGGCCACUGCUCCAGC^ G        UGU   -     C            CAAACAUGC 
     120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ami-Mir-219-P2_5p*

MirBase accessionMIMAT0038250
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Mature sequence

Ami-Mir-219-P2_3p

MirBase accessionMIMAT0038251
Sequence
45- AGAAUUGUGUCUGGACAUCUGU -67
Get sequence