MirGeneDB

MirGeneDB ID

Rno-Mir-219-P2-as

Family name MIR-219 (all species)
Seed GAAUUGC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-219b
Paralogues Rno-Mir-219-P1  Rno-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Eutheria
Node of Origin (family) Bilateria
Genome context
(rn6)
chr3: 8407445-8407509 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-219-P2-as)
Mir-219-P2 chr3: 8407443-8407507 [-] UCSC Ensembl
Mir-219-P2-as chr3: 8407445-8407509 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGUCUCUGUUGAGACCGGAGCUCAACCACAGAUGUCCAGCCACAAUUCUCGGUUGGCCGCAGACUCGUACAAGAAUUGCGUUUGGACAAUCAGUGGUGAAGCCCCUGAGUUCAGGGCUCCGGUC
Get precursor sequence
Structure
        10          20        30         40        50        60 
CCGUCUCUGUUGAGACC--  A   CA     A  -|      CCA       CGGUUGGCCG 
                   GG GCU  ACCAC GA UGUCCAG   CAAUUCU          C
                   CC CGA  UGGUG CU ACAGGUU   GUUAAGA          A
CUGGCCUCGGGACUUGAGU  C   AG     A  A^      UGC       ACAUGCUCAG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-219-P2-as_5p*

MirBase accessionMIMAT0017882
Sequence
0- AGAUGUCCAGCCACAAUUCUCG -22
Get sequence
Validated targets TargetScanVert: rno-miR-219b
miRDB: MIMAT0017882
Mature sequence

Rno-Mir-219-P2-as_3p

MirBase accessionNone
Sequence
42- AGAAUUGCGUUUGGACAAUCAGU -65
Get sequence