MirGeneDB

MirGeneDB ID

Gga-Mir-219-P2

Family name MIR-219 (all species)
Seed GAUUGUC
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-219a
Paralogues
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
17: 5485257-5485323 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGCGUGUCCGGGACGGGAAUCUCUGCUCCUGAUUGUCCAAACGCAAUUCUUGUGCGCUGGAGCCGUACGAACCAAGAAUUGUGUCUGGACAUCUGUAGCAGAGAUUUCGACUUCACCGGCGGGGCC
Get precursor sequence
Structure
        10          20        30        40        50        60   
CCGCGUGUCCGGGACGG--|          CCU   U     A            UGCGCUGGA 
                   GAAUCUCUGCU   GAU GUCCA ACGCAAUUCUUG         G
                   UUUAGAGACGA   CUA CAGGU UGUGUUAAGAAC         C
CCGGGGCGGCCACUUCAGC^          UGU   -     C            CAAGCAUGC 
     120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-219-P2_5p

MirBase accessionMIMAT0001170
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Validated targets TargetScanVert: gga-miR-219a
miRDB: MIMAT0001170
Star sequence

Gga-Mir-219-P2_3p*

MirBase accessionNone
Sequence
45- AGAAUUGUGUCUGGACAUCUGU -67
Get sequence