MirGeneDB

MirGeneDB ID

Mmu-Mir-219-P2-as

Family name MIR-219 (all species)
Seed GAAUUGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-219b
Paralogues Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Mmu-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Eutheria
Node of Origin (family) Bilateria
Genome context
(mm10)
chr2: 29845647-29845711 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-219-P2-as)
Mir-219-P2 chr2: 29845645-29845709 [-] UCSC Ensembl
Mir-219-P2-as chr2: 29845647-29845711 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCGUCUCUGUAGAGCCCGGAGCUCAACCACAGAUGUCCAGCCACAAUUCUCGGUUGGCCGCAGACUCGUACAAGAAUUGCGUUUGGACAAUCAGUGGCGAAGCCCCUGAGUUCAGGGCCCCGGUC
Get precursor sequence
Structure
        10          20        30         40        50        60 
UCGUCUCUGUAGAGCCC--  A   CAA    A  -|      CCA       CGGUUGGCCG 
                   GG GCU   CCAC GA UGUCCAG   CAAUUCU          C
                   CC CGA   GGUG CU ACAGGUU   GUUAAGA          A
CUGGCCCCGGGACUUGAGU  C   AGC    A  A^      UGC       ACAUGCUCAG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-219-P2-as_5p*

MirBase accessionMIMAT0029806
Sequence
0- AGAUGUCCAGCCACAAUUCUCG -22
Get sequence
Validated targets TargetScanVert: mmu-miR-219b-5p
miRDB: MIMAT0029806
Mature sequence

Mmu-Mir-219-P2-as_3p

MirBase accessionMIMAT0029807
Sequence
42- AGAAUUGCGUUUGGACAAUCAGU -65
Get sequence
Validated targets TargetScanVert: mmu-miR-219b-3p
miRDB: MIMAT0029807