MirGeneDB

MirGeneDB ID

Ocu-Mir-219-P2-as

Family name MIR-219 (all species)
Seed GAAUUGC
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID
Paralogues Ocu-Mir-219-P1  Ocu-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Eutheria
Node of Origin (family) Bilateria
Genome context
(oryCun2)
chrUn0149: 254880-254944 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGACCCUGCUGUGCCCAGAGCUCAGCCACAGAUGUCCAGCCACAAUUCUCGGUUGGCCGCAGACUCGUACAAGAAUUGCGUUUGGACAAUCAGUGGCGAAGCCCCUGAGUUCAGGGCCCCAGCU
Get precursor sequence
Structure
        10        20          30         40        50        60 
CCGACCCUGCUGUGCCCAGA--   CA     A  -|      CCA       CGGUUGGCCG 
                      GCU  GCCAC GA UGUCCAG   CAAUUCU          C
                      CGA  CGGUG CU ACAGGUU   GUUAAGA          A
UCGACCCCGGGACUUGAGUCCC   AG     A  A^      UGC       ACAUGCUCAG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-219-P2-as_5p*

MirBase accessionNone
Sequence
0- AGAUGUCCAGCCACAAUUCUCG -22
Get sequence
Mature sequence

Ocu-Mir-219-P2-as_3p

MirBase accessionNone
Sequence
42- AGAAUUGCGUUUGGACAAUCAGU -65
Get sequence