MirGeneDB

MirGeneDB ID

Sto-Mir-219-P2

Family name MIR-219 (all species)
Seed GAAUUGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2 
Orthologues Aae-Mir-219  Aca-Mir-219-P2  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P2  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P2  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01005837.1: 16504-16569 [+]
Precursor
(pre-Mir +30nt flank)
AGAGGAGACUUGCCCGAGGACCCCAGCUCUUGAUUGUCCGAACGCAAUUCUUGUGCUACAUGUUAACCAAACCAAGAAUUGUGUCUGGGCAUCUGAAGCCGGGUUUUGUCCAAUUGCCUUCCCAUC
Get precursor sequence
Structure
        10           20        30        40        50        60   
AGAGGAGACUUGCCCGA---|     CA   CUU   U     A            UGCUACAUG 
                    GGACCC  GCU   GAU GUCCG ACGCAAUUCUUG         \
                    UUUGGG  CGA   CUA CGGGU UGUGUUAAGAAC         U
CUACCCUUCCGUUAACCUGU^     C-   AGU   -     C            CAAACCAAU 
    120       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-219-P2_5p*

MirBase accessionNone
Sequence
0- UGAUUGUCCGAACGCAAUUCUUG -23
Get sequence
Mature sequence

Sto-Mir-219-P2_3p

MirBase accessionNone
Sequence
44- AGAAUUGUGUCUGGGCAUCUGA -66
Get sequence