MirGeneDB

MirGeneDB ID

Cin-Mir-219

Family name MIR-219 (all species)
Seed GAUUGUC
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-219
Paralogues
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Aca-Mir-219-P2  Ami-Mir-219-P1  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P1  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P1  Cpi-Mir-219-P2  Cpo-Mir-219-P1  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P1a  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Efe-Mir-219-P3  Efe-Mir-219-P4  Efe-Mir-219-P5  Ete-Mir-219-P1  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P1  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mdo-Mir-219-P2  Mml-Mir-219-P1  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P1  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P1  Sha-Mir-219-P2  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ci3)
7: 4370293-4370349 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUUGUUACGUCAAAAUGGCGUCUGUUUCGUGAUUGUCCAAACGCAAGCUCAGUUUUAAAAUACUGCGAUUGUGUCUGGACAUCUCAAAUCAGAAGGCUGCUGUCUUCAAAAACCAA
Get precursor sequence
Structure
        10         20         30         40        50        
AAUUGUUACGUCAAAAU-   G-|   UUUCG   U-      A      GCU   UUUU 
                  GGC  UCUG     UGA  UGUCCA ACGCAA   CAG    A
                  UCG  AGAC     ACU  ACAGGU UGUGUU   GUC    A
AACCAAAAACUUCUGUCG   GA^   UAA--   CU      C      AGC   AUAA 
     110       100        90          80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-219_5p

MirBase accessionMIMAT0006113
Sequence
0- UGAUUGUCCAAACGCAAGCUCAG -23
Get sequence
Star sequence

Cin-Mir-219_3p*

MirBase accessionMIMAT0015264
Sequence
35- GCGAUUGUGUCUGGACAUCUCA -57
Get sequence