MirGeneDB

MirGeneDB ID

Sko-Mir-219

Family name MIR-219 (all species)
Seed GAUUGUC
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-219
Paralogues
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Aca-Mir-219-P2  Ami-Mir-219-P1  Ami-Mir-219-P2  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Bta-Mir-219-P2  Bta-Mir-219-P2-as  Cfa-Mir-219-P1  Cfa-Mir-219-P2  Cfa-Mir-219-P2-as  Cgi-Mir-219  Cin-Mir-219  Cli-Mir-219-P2  Cpi-Mir-219-P1  Cpi-Mir-219-P2  Cpo-Mir-219-P1  Cpo-Mir-219-P2  Cpo-Mir-219-P2-as  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dno-Mir-219-P2  Dno-Mir-219-P2-as  Dpu-Mir-219  Dre-Mir-219-P1a  Dre-Mir-219-P2a  Dre-Mir-219-P2b  Efe-Mir-219-P3  Efe-Mir-219-P4  Efe-Mir-219-P5  Ete-Mir-219-P1  Ete-Mir-219-P2  Gga-Mir-219-P2  Hsa-Mir-219-P1  Hsa-Mir-219-P2  Hsa-Mir-219-P2-as  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mdo-Mir-219-P2  Mml-Mir-219-P1  Mml-Mir-219-P2  Mml-Mir-219-P2-as  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Mmu-Mir-219-P2  Mmu-Mir-219-P2-as  Oan-Mir-219-P2  Ocu-Mir-219-P1  Ocu-Mir-219-P2  Ocu-Mir-219-P2-as  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Rno-Mir-219-P2  Rno-Mir-219-P2-as  Sha-Mir-219-P1  Sha-Mir-219-P2  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Sto-Mir-219-P2  Tca-Mir-219  Tgu-Mir-219-P2  Xtr-Mir-219-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003144276.1: 316-377 [-]
Precursor
(pre-Mir +30nt flank)
AUCUGGUAUGGACGUCUUGGUGACAAGCUCUGAUUGUCCAAACGCAAUUCUUGUGUUUUCUUAACUAAACAAGAGCUGUGCUGGGCAUCACAAGUUGUCAUCAACAAUCAACAAUACAACUU
Get precursor sequence
Structure
        10          20        30         40        50        60 
AUCUGGUAUGGACGUCU--|        G  C-    U     AA    A      UGUUUUC 
                   UGGUGACAA CU  UGAU GUCCA  CGCA UUCUUG       U
                   ACUACUGUU GA  ACUA CGGGU  GUGU GAGAAC       U
UUCAACAUAACAACUAACA^        -  AC    -     C-    C      AAAUCAA 
120       110       100         90          80        70
Deep sequencing
CommentThere are approximately 30 Mir-219 loci in S. kowalevskii clustered on a single genomic trace but only one is annotated here as there are no Mir-219 reads in the initial 454 library.
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sko-Mir-219_5p (predicted)

MirBase accessionMIMAT0022768
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Star sequence

Sko-Mir-219_3p* (predicted)

MirBase accessionNone
Sequence
41- AGAGCUGUGCUGGGCAUCACA -62
Get sequence