MirGeneDB

MirGeneDB ID

Isc-Mir-7

Family name MIR-7 (all species)
Seed GGAAGAC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-7
Paralogues
Orthologues Aae-Mir-7  Aca-Mir-7-P1  Aca-Mir-7-P2  Aca-Mir-7-P3  Ami-Mir-7-P1  Ami-Mir-7-P2  Ami-Mir-7-P3  Ami-Mir-7-P4  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P1  Bta-Mir-7-P2  Bta-Mir-7-P3  Cfa-Mir-7-P1  Cfa-Mir-7-P2  Cfa-Mir-7-P3  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P1  Cli-Mir-7-P2  Cli-Mir-7-P3  Cli-Mir-7-P4  Cpi-Mir-7-P1  Cpi-Mir-7-P2  Cpi-Mir-7-P3  Cpi-Mir-7-P4  Cpo-Mir-7-P1  Cpo-Mir-7-P2  Cpo-Mir-7-P3  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P1  Dno-Mir-7-P2  Dno-Mir-7-P3  Dpu-Mir-7-P5  Dpu-Mir-7-P6  Dre-Mir-7-o1  Dre-Mir-7-P1  Dre-Mir-7-P2a  Dre-Mir-7-P2b  Efe-Mir-7-P7  Efe-Mir-7-P8  Efe-Mir-7-P9  Ete-Mir-7-P1  Ete-Mir-7-P2  Ete-Mir-7-P3  Gga-Mir-7-P1a  Gga-Mir-7-P1b  Gga-Mir-7-P2  Gga-Mir-7-P3  Hme-Mir-7  Hsa-Mir-7-P1  Hsa-Mir-7-P2  Hsa-Mir-7-P3  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P1  Mdo-Mir-7-P2  Mdo-Mir-7-P3  Mml-Mir-7-P1  Mml-Mir-7-P2  Mml-Mir-7-P3  Mmu-Mir-7-P1  Mmu-Mir-7-P2  Mmu-Mir-7-P3  Oan-Mir-7-P1  Oan-Mir-7-P2  Ocu-Mir-7-P1  Ocu-Mir-7-P2  Ocu-Mir-7-P3  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P1  Rno-Mir-7-P2  Rno-Mir-7-P3  Sha-Mir-7-P1  Sha-Mir-7-P2  Sha-Mir-7-P3  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P1  Sto-Mir-7-P2  Sto-Mir-7-P3  Tgu-Mir-7-P1  Tgu-Mir-7-P2c  Tgu-Mir-7-P2d  Tgu-Mir-7-P3  Xtr-Mir-7-P1  Xtr-Mir-7-P2  Xtr-Mir-7-P4 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS629750: 8363-8423 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCCCGCACCGGCCACCGGGGCCCUCCCGUCUGGAAGACUAGUGAUUUUGUUGUUCUGUCAAACUUGGAAACAAGAAAUCACUAUCUCCGAACGGUGGGCGCCCUCGUCACAACAUCGGCGG
Get precursor sequence
Structure
        10         20         30        40        50        60 
UCCCGCACCGGCCACCG-    -| UC    C    A  C          G     CUGUCA 
                  GGGC CC  CCGU UGGA GA UAGUGAUUUU UUGUU      A
                  CCCG GG  GGCA GCCU CU AUCACUAAAG AACAA      A
GGCGGCUACAACACUGCU    C^ GU    A    -  -          -     AGGUUC 
 .       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-7_5p

MirBase accessionMIMAT0012702
Sequence
0- UGGAAGACUAGUGAUUUUGUUGUU -24
Get sequence
Star sequence

Isc-Mir-7_3p*

MirBase accessionNone
Sequence
40- CAAGAAAUCACUAUCUCCGAA -61
Get sequence