MirGeneDB

MirGeneDB ID

Rno-Mir-7-P1

Family name MIR-7 (all species)
Seed GGAAGAC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-7a-1
Paralogues Rno-Mir-7-P2  Rno-Mir-7-P3 
Orthologues Aae-Mir-7  Aca-Mir-7-P1  Ami-Mir-7-P1  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P1  Cfa-Mir-7-P1  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P1  Cpi-Mir-7-P1  Cpo-Mir-7-P1  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P1  Dre-Mir-7-o1  Dre-Mir-7-P1  Ete-Mir-7-P1  Gga-Mir-7-P1a  Gga-Mir-7-P1b  Hme-Mir-7  Hsa-Mir-7-P1  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P1  Mml-Mir-7-P1  Mmu-Mir-7-P1  Oan-Mir-7-P1  Ocu-Mir-7-P1  Pfl-Mir-7  Pmi-Mir-7  Sha-Mir-7-P1  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P1  Tgu-Mir-7-P1  Xtr-Mir-7-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr17: 6675034-6675097 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGUCAUUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAGACGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCACCUCUACAGGACAGACAA
Get precursor sequence
Structure
        10           20        30        40        50        60  
AGAGUCAUUGGAUGUUG---|   A  U        A     A       U      UUUAGAU 
                    GCCU GU CUGUGUGG AGACU GUGAUUU GUUGUU       A
                    CGGA CA GGUAUACC UCUGA CACUAAA CAACAG       A
AACAGACAGGACAUCUCCAC^   -  C        G     -       -      CAGAAUC 
  120       110        100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-7-P1_5p

MirBase accessionMIMAT0000606
Sequence
0- UGGAAGACUAGUGAUUUUGUUGUU -24
Get sequence
Validated targets microrna.org: MIMAT0000606
TargetScanVert: rno-miR-7a-5p
miRDB: MIMAT0000606
Star sequence

Rno-Mir-7-P1_3p*

MirBase accessionMIMAT0000607
Sequence
42- CAACAAAUCACAGUCUGCCAUA -64
Get sequence
Validated targets microrna.org: MIMAT0000607
TargetScanVert: rno-miR-7a-1-3p
miRDB: MIMAT0000607