MirGeneDB

MirGeneDB ID

Bta-Mir-7-P2

Family name MIR-7 (all species)
Seed GGAAGAC
Species Cow (Bos taurus)
MiRBase ID bta-mir-7-1
Paralogues Bta-Mir-7-P1  Bta-Mir-7-P3 
Orthologues Aae-Mir-7  Aca-Mir-7-P2  Ami-Mir-7-P2  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Cfa-Mir-7-P2  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P2  Cpi-Mir-7-P2  Cpo-Mir-7-P2  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P2  Dre-Mir-7-P2a  Dre-Mir-7-P2b  Ete-Mir-7-P2  Gga-Mir-7-P2  Hme-Mir-7  Hsa-Mir-7-P2  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P2  Mml-Mir-7-P2  Mmu-Mir-7-P2  Oan-Mir-7-P2  Ocu-Mir-7-P2  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P2  Sha-Mir-7-P2  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P2  Tgu-Mir-7-P2c  Tgu-Mir-7-P2d  Xtr-Mir-7-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr21: 19989084-19989144 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGCUGCCGCCGUGGAGCAGCCAGCCCCAUCUGGAAGACUAGUGAUUUUGUUGUUGUCUCCUGCGCUCAACAACAAGUCCCAGUCUGCCGCAUGGUGCUGGCCACCGCAGCCGGGGCAGGGG
Get precursor sequence
Structure
        10          20        30        40        50        60 
CGCUGCCGCCGUGGAGCA--|     C    C   A     AGU     U      GUCUCC 
                    GCCAGC CCAU UGG AGACU   GAUUU GUUGUU      \
                    CGGUCG GGUA GCC UCUGA   CUGAA CAACAA      U
GGGGACGGGGCCGACGCCAC^     U    C   G     CC-     -      CUCGCG 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-7-P2_5p

MirBase accessionMIMAT0003843
Sequence
0- UGGAAGACUAGUGAUUUUGUUGUU -24
Get sequence
Validated targets TargetScanVert: bta-miR-7
Star sequence

Bta-Mir-7-P2_3p*

MirBase accessionNone
Sequence
39- CAACAAGUCCCAGUCUGCCGCA -61
Get sequence