MirGeneDB

MirGeneDB ID

Sko-Mir-103

Family name MIR-103 (all species)
Seed GCAGCAU
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-2013
Paralogues
Orthologues Aca-Mir-103-P1  Aca-Mir-103-P2  Aca-Mir-103-P3  Ami-Mir-103-P1  Ami-Mir-103-P2  Bfl-Mir-103  Bta-Mir-103-P1  Bta-Mir-103-P2  Bta-Mir-103-P3  Cfa-Mir-103-P1  Cfa-Mir-103-P2  Cfa-Mir-103-P3  Cli-Mir-103-P1  Cli-Mir-103-P2  Cli-Mir-103-P3  Cpi-Mir-103-P1  Cpi-Mir-103-P2  Cpi-Mir-103-P3  Cpo-Mir-103-P1  Cpo-Mir-103-P2  Cpo-Mir-103-P3  Dno-Mir-103-P1  Dno-Mir-103-P2  Dno-Mir-103-P3  Dre-Mir-103-P2  Dre-Mir-103-P3a  Dre-Mir-103-P3b  Ete-Mir-103-P1  Ete-Mir-103-P2  Ete-Mir-103-P3  Gga-Mir-103-P1  Gga-Mir-103-P2  Gga-Mir-103-P3  Hsa-Mir-103-P1  Hsa-Mir-103-P2  Hsa-Mir-103-P3  Mdo-Mir-103-P1  Mdo-Mir-103-P2  Mdo-Mir-103-P3  Mml-Mir-103-P1  Mml-Mir-103-P2  Mml-Mir-103-P3  Mmu-Mir-103-P1  Mmu-Mir-103-P2  Mmu-Mir-103-P3  Oan-Mir-103-P1  Oan-Mir-103-P2  Oan-Mir-103-P3  Ocu-Mir-103-P1  Ocu-Mir-103-P2  Ocu-Mir-103-P3  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P1  Rno-Mir-103-P2  Rno-Mir-103-P3  Sha-Mir-103-P1  Sha-Mir-103-P2  Sha-Mir-103-P3  Spu-Mir-103  Sto-Mir-103-P1  Sto-Mir-103-P2  Sto-Mir-103-P3  Tgu-Mir-103-P1  Tgu-Mir-103-P2  Tgu-Mir-103-P3  Xtr-Mir-103-P1  Xtr-Mir-103-P2  Xtr-Mir-103-P3 
Node of Origin (locus) Deuterostomia
Node of Origin (family) Deuterostomia
Genome context
(Skow_1.1)
NW_003120936.1: 115062-115119 [-]
Clustered MiRNAs
(< 10kb from Mir-103)
Mir-103 NW_003120936.1: 115062-115119 [-]
Mir-4834 NW_003120936.1: 115391-115447 [-]
Precursor
(pre-Mir +30nt flank)
ACUACCAUGGAAUAUCUGCUCUUUACUGCACAUCGCUAUUUCUUGCUGGCACCAUCUGAUUAAAGGUGCAGCAUGAUGUAGUGGUGUGCAGUGGAGUAAAUAAACAACAGUACUCUGU
Get precursor sequence
Structure
        10            20        30        40        50         
ACUACCAUGGAAUAUCU----|    UU               U  U     G   CAUCUG 
                     GCUCU  ACUGCACAUCGCUAU UC UGCUG CAC      \
                     UGAGG  UGACGUGUGGUGAUG AG ACGAC GUG      A
UGUCUCAUGACAACAAAUAAA^    --               U  U     -   GAAAUU 
      110       100          90        80        70         60
Deep sequencing
Go to detailed chart
CommentThere is a polymorphism between the genomic read and the actual 3p read from the small RNA library (UGCAGCAUGAUGUAGUGGUGUA).
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sko-Mir-103_5p* (predicted)

MirBase accessionNone
Sequence
0- CAUCGCUAUUUCUUGCUGGCAC -22
Get sequence
Mature sequence

Sko-Mir-103_3p

MirBase accessionMIMAT0009737
Sequence
36- UGCAGCAUGAUGUAGUGGUGUG -58
Get sequence