MirGeneDB

MirGeneDB ID

Cli-Mir-103-P1

Family name MIR-103 (all species)
Seed GCAGCAU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-103-1
Paralogues Cli-Mir-103-P2  Cli-Mir-103-P3 
Orthologues Aca-Mir-103-P1  Ami-Mir-103-P1  Bfl-Mir-103  Bta-Mir-103-P1  Cfa-Mir-103-P1  Cpi-Mir-103-P1  Cpo-Mir-103-P1  Dno-Mir-103-P1  Ete-Mir-103-P1  Gga-Mir-103-P1  Hsa-Mir-103-P1  Mdo-Mir-103-P1  Mml-Mir-103-P1  Mmu-Mir-103-P1  Oan-Mir-103-P1  Ocu-Mir-103-P1  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P1  Sha-Mir-103-P1  Sko-Mir-103  Spu-Mir-103  Sto-Mir-103-P1  Tgu-Mir-103-P1  Xtr-Mir-103-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(colLiv2)
scaffold79: 13537713-13537772 [+]
Precursor
(pre-Mir +30nt flank)
AAGGAACAUCUGUUAUGUCUUACUGUCUUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUGAGUCUUCUCUACCAAAUAUGUA
Get precursor sequence
Structure
        10          20        30          40        50         
AAGGAACAUCUGUUAUGU--    C       --|   U  U           C   UUGCA 
                    CUUA UGUCUUC  GGCU CU UACAGUGCUGC UUG     U
                    GAGU ACGGAAG  UCGG GA AUGUUACGACG AAC     A
AUGUAUAAACCAUCUCUUCU    U       UA^   -  C           -   UAGGU 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-103-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- GGCUUCUUUACAGUGCUGCCUUG -23
Get sequence
Mature sequence

Cli-Mir-103-P1_3p

MirBase accessionMIMAT0038485
Sequence
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence