MirGeneDB

MirGeneDB ID

Cli-Mir-103-P2

Family name MIR-103 (all species)
Seed GCAGCAU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-103-2
Paralogues Cli-Mir-103-P1  Cli-Mir-103-P3 
Orthologues Aca-Mir-103-P2  Ami-Mir-103-P2  Bfl-Mir-103  Bta-Mir-103-P2  Cfa-Mir-103-P2  Cpi-Mir-103-P2  Cpo-Mir-103-P2  Dno-Mir-103-P2  Dre-Mir-103-P2  Ete-Mir-103-P2  Gga-Mir-103-P2  Hsa-Mir-103-P2  Mdo-Mir-103-P2  Mml-Mir-103-P2  Mmu-Mir-103-P2  Oan-Mir-103-P2  Ocu-Mir-103-P2  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P2  Sha-Mir-103-P2  Sko-Mir-103  Spu-Mir-103  Sto-Mir-103-P2  Tgu-Mir-103-P2  Xtr-Mir-103-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(colLiv2)
scaffold203: 1112346-1112405 [-]
Precursor
(pre-Mir +30nt flank)
ACCGCCGUUCCUGGUUAUCUUUGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUUGCGUUCAUGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAGCAGAGACGAGCGCUCCGCUCUCUCC
Get precursor sequence
Structure
        10          20        30          40        50         
ACCGCCGUUCCUGGUUA--       G     --|   U  U           C   UUGCG 
                   UCUUUGU CUUUC  AGCU CU UACAGUGCUGC UUG     U
                   AGAGACG GAAAG  UCGG GA AUGUUACGACG AAC     U
CCUCUCUCGCCUCGCGAGC       A     UA^   -  C           -   UGUAC 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-103-P2_5p*

MirBase accessionMIMAT0038486
Sequence
0- AGCUUCUUUACAGUGCUGCCUUGU -24
Get sequence
Mature sequence

Cli-Mir-103-P2_3p

MirBase accessionMIMAT0038485
Sequence
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence