MirGeneDB

MirGeneDB ID

Aca-Mir-103-P2

Family name MIR-103 (all species)
Seed GCAGCAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-103-P1  Aca-Mir-103-P3 
Orthologues Ami-Mir-103-P2  Bfl-Mir-103  Bta-Mir-103-P2  Cfa-Mir-103-P2  Cli-Mir-103-P2  Cpi-Mir-103-P2  Cpo-Mir-103-P2  Dno-Mir-103-P2  Dre-Mir-103-P2  Ete-Mir-103-P2  Gga-Mir-103-P2  Hsa-Mir-103-P2  Mdo-Mir-103-P2  Mml-Mir-103-P2  Mmu-Mir-103-P2  Oan-Mir-103-P2  Ocu-Mir-103-P2  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P2  Sha-Mir-103-P2  Sko-Mir-103  Spu-Mir-103  Sto-Mir-103-P2  Tgu-Mir-103-P2  Xtr-Mir-103-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(anoCar2)
G889P66450RD9: 417-476 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGAUGGUUUCCCCAAAGCUUGGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUUGCAACCAUGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAACCAAGGCCUACUCGCCUUGUUGCUU
Get precursor sequence
Structure
        10          20        30          40        50         
UUGAUGGUUUCCCCAAAG--      G     --|   U  U           C   UUGCA 
                    CUUGGU CUUUC  AGCU CU UACAGUGCUGC UUG     A
                    GAACCA GAAAG  UCGG GA AUGUUACGACG AAC     C
UUCGUUGUUCCGCUCAUCCG      A     UA^   -  C           -   UGUAC 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-103-P2_5p*

MirBase accessionNone
Sequence
0- AGCUUCUUUACAGUGCUGCCUUGU -24
Get sequence
Mature sequence

Aca-Mir-103-P2_3p

MirBase accessionNone
Sequence
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence