MirGeneDB

MirGeneDB ID

Sto-Mir-103-P2

Family name MIR-103 (all species)
Seed GCAGCAU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-103-P1  Sto-Mir-103-P3 
Orthologues Aca-Mir-103-P2  Ami-Mir-103-P2  Bfl-Mir-103  Bta-Mir-103-P2  Cfa-Mir-103-P2  Cli-Mir-103-P2  Cpi-Mir-103-P2  Cpo-Mir-103-P2  Dno-Mir-103-P2  Dre-Mir-103-P2  Ete-Mir-103-P2  Gga-Mir-103-P2  Hsa-Mir-103-P2  Mdo-Mir-103-P2  Mml-Mir-103-P2  Mmu-Mir-103-P2  Oan-Mir-103-P2  Ocu-Mir-103-P2  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P2  Sha-Mir-103-P2  Sko-Mir-103  Spu-Mir-103  Tgu-Mir-103-P2  Xtr-Mir-103-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(miRNA_loci_genome)
BFAA01003951.1: 146390-146449 [-]
Precursor
(pre-Mir +30nt flank)
ACAUGGGAGGAAAUGAUGCUUUGUGUUUUCAGCUUCUUUACAGUGCUGCCUUGUAGCAUCCAGAUCAAGCAGCAUUGUACAGGGCUAUGAAAGCACAGAGACACAUACUGCAAGUGCAAA
Get precursor sequence
Structure
        10          20        30          40        50         
ACAUGGGAGGAAAUGAUG--            --|   U  U           C   UAGCA 
                    CUUUGUGUUUUC  AGCU CU UACAGUGCUGC UUG     U
                    GAGACACGAAAG  UCGG GA AUGUUACGACG AAC     C
AAACGUGAACGUCAUACACA            UA^   -  C           -   UAGAC 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-103-P2_5p*

MirBase accessionNone
Sequence
0- AGCUUCUUUACAGUGCUGCCUUGU -24
Get sequence
Mature sequence

Sto-Mir-103-P2_3p

MirBase accessionNone
Sequence
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence