MirGeneDB

MirGeneDB ID

Spu-Mir-103

Family name MIR-103 (all species)
Seed GCAGCAU
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2013
Paralogues
Orthologues Aca-Mir-103-P1  Aca-Mir-103-P2  Aca-Mir-103-P3  Ami-Mir-103-P1  Ami-Mir-103-P2  Bfl-Mir-103  Bta-Mir-103-P1  Bta-Mir-103-P2  Bta-Mir-103-P3  Cfa-Mir-103-P1  Cfa-Mir-103-P2  Cfa-Mir-103-P3  Cli-Mir-103-P1  Cli-Mir-103-P2  Cli-Mir-103-P3  Cpi-Mir-103-P1  Cpi-Mir-103-P2  Cpi-Mir-103-P3  Cpo-Mir-103-P1  Cpo-Mir-103-P2  Cpo-Mir-103-P3  Dno-Mir-103-P1  Dno-Mir-103-P2  Dno-Mir-103-P3  Dre-Mir-103-P2  Dre-Mir-103-P3a  Dre-Mir-103-P3b  Ete-Mir-103-P1  Ete-Mir-103-P2  Ete-Mir-103-P3  Gga-Mir-103-P1  Gga-Mir-103-P2  Gga-Mir-103-P3  Hsa-Mir-103-P1  Hsa-Mir-103-P2  Hsa-Mir-103-P3  Mdo-Mir-103-P1  Mdo-Mir-103-P2  Mdo-Mir-103-P3  Mml-Mir-103-P1  Mml-Mir-103-P2  Mml-Mir-103-P3  Mmu-Mir-103-P1  Mmu-Mir-103-P2  Mmu-Mir-103-P3  Oan-Mir-103-P1  Oan-Mir-103-P2  Oan-Mir-103-P3  Ocu-Mir-103-P1  Ocu-Mir-103-P2  Ocu-Mir-103-P3  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P1  Rno-Mir-103-P2  Rno-Mir-103-P3  Sha-Mir-103-P1  Sha-Mir-103-P2  Sha-Mir-103-P3  Sko-Mir-103  Sto-Mir-103-P1  Sto-Mir-103-P2  Sto-Mir-103-P3  Tgu-Mir-103-P1  Tgu-Mir-103-P2  Tgu-Mir-103-P3  Xtr-Mir-103-P1  Xtr-Mir-103-P2  Xtr-Mir-103-P3 
Node of Origin (locus) Deuterostomia
Node of Origin (family) Deuterostomia
Genome context
(Spur_3.1)
Scaffold823: 265549-265613 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACGAAGCUGUCAUUGAUGUCUACUGUUCUACGCCGCUACAUCUAGUUGCAUUGUGACGUCUGUUUCAGGGAAAUGCAGCAUGAUGUAGUGGUGUAGCUCAGUAAGACCAUUCCAACCAGCCGGCA
Get precursor sequence
Structure
        10         20         30        40        50        60  
ACGAAGCUGUCAUUGAU-   -|    UU               UA        GUGACGUCU 
                  GUC UACUG  CUACGCCGCUACAUC  GUUGCAUU         \
                  CAG AUGAC  GAUGUGGUGAUGUAG  CGACGUAA         G
ACGGCCGACCAACCUUAC   A^    UC               UA        AGGGACUUU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-103_5p* (predicted)

MirBase accessionNone
Sequence
0- CGCCGCUACAUCUAGUUGCAUU -22
Get sequence
Mature sequence

Spu-Mir-103_3p

MirBase accessionMIMAT0009742
Sequence
43- UGCAGCAUGAUGUAGUGGUGUA -65
Get sequence