MirGeneDB

MirGeneDB ID

Mmu-Mir-103-P2

Family name MIR-103 (all species)
Seed GCAGCAU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-103-2
Paralogues Mmu-Mir-103-P1  Mmu-Mir-103-P3 
Orthologues Aca-Mir-103-P2  Ami-Mir-103-P2  Bfl-Mir-103  Bta-Mir-103-P2  Cfa-Mir-103-P2  Cli-Mir-103-P2  Cpi-Mir-103-P2  Cpo-Mir-103-P2  Dno-Mir-103-P2  Dre-Mir-103-P2  Ete-Mir-103-P2  Gga-Mir-103-P2  Hsa-Mir-103-P2  Mdo-Mir-103-P2  Mml-Mir-103-P2  Oan-Mir-103-P2  Ocu-Mir-103-P2  Pfl-Mir-103  Pmi-Mir-103  Rno-Mir-103-P2  Sha-Mir-103-P2  Sko-Mir-103  Spu-Mir-103  Sto-Mir-103-P2  Tgu-Mir-103-P2  Xtr-Mir-103-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Deuterostomia
Genome context
(mm10)
chr2: 131288066-131288125 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCACCUCAGCAGAGCUGUCUUCGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUAGCAUUCAGGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAACCAAGAAUGGGCUGCCCUUAGGGAA
Get precursor sequence
Structure
        10          20        30          40        50         
CCACCUCAGCAGAGCUG--    C  G     --|   U  U           C   UAGCA 
                   UCUU GU CUUUC  AGCU CU UACAGUGCUGC UUG     U
                   AGAA CA GAAAG  UCGG GA AUGUUACGACG AAC     U
AAGGGAUUCCCGUCGGGUA    C  A     UA^   -  C           -   UGGAC 
.       110       100        90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-103-P2_5p*

MirBase accessionMIMAT0017025
Sequence
0- AGCUUCUUUACAGUGCUGCCUUGU -24
Get sequence
Validated targets TargetScanVert: mmu-miR-103-2-5p
miRDB: MIMAT0017025
Mature sequence

Mmu-Mir-103-P2_3p

MirBase accessionMIMAT0000546
Sequence
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence
Validated targets microrna.org: MIMAT0000546
TargetScanVert: mmu-miR-103-3p
miRDB: MIMAT0000546