MirGeneDB ID | Sko-Mir-22-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Saccoglossus (Saccoglossus kowalevskii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | sko-mir-4834 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Aae-Mir-22-P2 Aga-Mir-22-P2 Agr-Mir-22-P2 Asu-Mir-22-P2 Bfl-Mir-22-P2a Bfl-Mir-22-P2b Bfl-Mir-22-P2c Bge-Mir-22-P2 Bla-Mir-22-P2a Bla-Mir-22-P2b Bla-Mir-22-P2c Cbr-Mir-22-P2-v1 Cel-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dlo-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Eba-Mir-22-P2 Esc-Mir-22-P2 Gpa-Mir-22-P2 Hme-Mir-22-P2 Hru-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lhy-Mir-22-P2 Llo-Mir-22-P2 Lpo-Mir-22-P2f Lpo-Mir-22-P2g Lpo-Mir-22-P2h Lpo-Mir-22-P2i Mgi-Mir-22-P2 Mom-Mir-22-P2 Npo-Mir-22-P2 Ofu-Mir-22-P2j Ofu-Mir-22-P2k Ovu-Mir-22-P2 Pau-Mir-22-P2 Pca-Mir-22-P2 Pcr-Mir-22-P2l Pcr-Mir-22-P2m Pdu-Mir-22-P2 Pfl-Mir-22-P2 Pmi-Mir-22-P2 Pve-Mir-22-P2 Rph-Mir-22-P2 Snu-Mir-22-P2 Spu-Mir-22-P2 Tca-Mir-22-P2-v1 Tur-Mir-22-P2 War-Mir-22-P2 Xbo-Mir-22-P2d Xbo-Mir-22-P2e | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Skow_1.1) |
NW_003120936.1: 115391-115447 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-22-P2) |
Mir-103
NW_003120936.1: 115062-115119 [-]
Mir-22-P2 NW_003120936.1: 115391-115447 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | CAGCUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GUUUUAUUUAUGAUUUGCCUUGCCUUGCUACACUUCACGCUGCAUGCUAUUGCUUAUACCUCUCAACAGCUGCUACGUGGAGUGGAGCAGUGUACCAGGUAGUAGCUGCUGUCAUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GUUUUAUUUAUGAUUUG- --| C A CU U A CUUAU CCU UGC UUGCU CACUUCACG GCA GCU UUG \ GGA AUG GACGA GUGAGGUGC CGU CGA AAC A CUUACUGUCGUCGAUGAU CC^ U G AU - C UCUCC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o1 gene in Branchiostoma and Xenoturbella. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Sko-Mir-22-P2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CACUUCACGCUGCAUGCUAUUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Sko-Mir-22-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0020050 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
35- ACAGCUGCUACGUGGAGUGGAG -57
Get sequence
|