| MirGeneDB ID | Pfl-Mir-22-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Ptychodera (Ptychodera flava) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pfl-Mir-22-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-22-P2 Aga-Mir-22-P2 Agr-Mir-22-P2 Asu-Mir-22-P2 Bfl-Mir-22-P2a Bfl-Mir-22-P2b Bfl-Mir-22-P2c Bge-Mir-22-P2 Bla-Mir-22-P2a Bla-Mir-22-P2b Bla-Mir-22-P2c Cbr-Mir-22-P2-v1 Cel-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dlo-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Eba-Mir-22-P2 Esc-Mir-22-P2 Gpa-Mir-22-P2 Hme-Mir-22-P2 Hru-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lhy-Mir-22-P2 Llo-Mir-22-P2 Lpo-Mir-22-P2f Lpo-Mir-22-P2g Lpo-Mir-22-P2h Lpo-Mir-22-P2i Mgi-Mir-22-P2 Mom-Mir-22-P2 Npo-Mir-22-P2 Ofu-Mir-22-P2j Ofu-Mir-22-P2k Ovu-Mir-22-P2 Pau-Mir-22-P2 Pca-Mir-22-P2 Pcr-Mir-22-P2l Pcr-Mir-22-P2m Pdu-Mir-22-P2 Pmi-Mir-22-P2 Pve-Mir-22-P2 Rph-Mir-22-P2 Sko-Mir-22-P2 Snu-Mir-22-P2 Spu-Mir-22-P2 Tca-Mir-22-P2-v1 Tur-Mir-22-P2 War-Mir-22-P2 Xbo-Mir-22-P2d Xbo-Mir-22-P2e | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pfl) |
LD346721.1: 582412-582474 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-22-P2) |
Mir-22-P1
LD346721.1: 581033-581090 [-]
Mir-103 LD346721.1: 581831-581890 [-] Mir-22-P2 LD346721.1: 582412-582474 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGCUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUCAAAUAAGUGCAAUGCUUUGCAUUGCUACACUUCACGCUGCAAGCUAUUGUCAAGUGGUUUAAAUGUCAACAGCUGCUACGUGGAGUGGAGCAAGGUCAAAGGUCAUUUCUUCCAGUCAUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CUCAAAUAAGUGCAAUG-- -|A A CU A A UCAAGUGG CUUUG C UUGCU CACUUCACG GCA GCU UUG \ GAAAC G AACGA GUGAGGUGC CGU CGA AAC U AUACUGACCUUCUUUACUG U^G G AU - C UGUAAAUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o1 gene in Branchiostoma and Xenoturbella. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pfl-Mir-22-P2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CACUUCACGCUGCAAGCUAUUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pfl-Mir-22-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- ACAGCUGCUACGUGGAGUGGAG -63
Get sequence
|
