| MirGeneDB ID | Bfl-Mir-22-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | bfl-mir-4868b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Bfl-Mir-22-o3d Bfl-Mir-22-o3e Bfl-Mir-22-P1 Bfl-Mir-22-P2a Bfl-Mir-22-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-22-P2 Aga-Mir-22-P2 Agr-Mir-22-P2 Asu-Mir-22-P2 Bge-Mir-22-P2 Bla-Mir-22-P2b Cbr-Mir-22-P2-v1 Cel-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dlo-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Eba-Mir-22-P2 Esc-Mir-22-P2 Gpa-Mir-22-P2 Hme-Mir-22-P2 Hru-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lhy-Mir-22-P2 Llo-Mir-22-P2 Mgi-Mir-22-P2 Mom-Mir-22-P2 Npo-Mir-22-P2 Ovu-Mir-22-P2 Pau-Mir-22-P2 Pca-Mir-22-P2 Pdu-Mir-22-P2 Pfl-Mir-22-P2 Pmi-Mir-22-P2 Pve-Mir-22-P2 Rph-Mir-22-P2 Sko-Mir-22-P2 Snu-Mir-22-P2 Spu-Mir-22-P2 Tca-Mir-22-P2-v1 Tur-Mir-22-P2 War-Mir-22-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049981.1: 9942475-9942534 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-22-P2b) |
Mir-22-P2b
NC_049981.1: 9942475-9942534 [-]
UCSC
Mir-4868-P2 NC_049981.1: 9942475-9942534 [-] UCSC Mir-22-P2a NC_049981.1: 9953158-9953217 [-] UCSC Mir-4868-P1 NC_049981.1: 9953158-9953217 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGCUCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUUUCACCUAUGGUAAGCGUGUCGGCUUCCCUCAUCACACCGGAAGCUGUUACGUCACUUCCGCUGUAUCAGCUCCAGCUGUGAUGAGUGAAGGGGCAUGCACAGAACAACAGUACAACGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUUUCACCUAUGGUAAG---| GG C CC- A U CGUCAC CGUGUC CUUC CUCAUCACA GGA GCUG UA U GUACGG GAAG GAGUAGUGU CCU CGAC AU U GCAACAUGACAACAAGACAC^ G- U CGA - U GUCGCC . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o2 gene in ambulacrarians. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bfl-Mir-22-P2b_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUCAUCACACCGGAAGCUGUUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bfl-Mir-22-P2b_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0020105 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UCAGCUCCAGCUGUGAUGAGUG -60
Get sequence
|
