MirGeneDB

MirGeneDB ID

Dan-Mir-22-P2

Family name MIR-22 (all species)
Seed AGCUGCC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-22-P2  Asu-Mir-22-P2  Bge-Mir-22-P2  Cbr-Mir-22-P2-v1  Cbr-Mir-22-P2-v2  Cel-Mir-22-P2  Cgi-Mir-22-P2  Cte-Mir-22-P2  Dme-Mir-22-P2  Dmo-Mir-22-P2  Dpu-Mir-22-P2  Hme-Mir-22-P2  Lan-Mir-22-P2  Lgi-Mir-22-P2  Tca-Mir-22-P2-v1  Tca-Mir-22-P2-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13117: 4815211-4815276 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAAUGUCCUAGGAAGUAAUUUGUAUGUCAGCCUCUCAUUUGGCCUGCCUAGCUGACUUUAAAUUAAUAUUGCUAGCUGCCUUGUGAAGGGCUUACGUGUGAUUGCGAUUCAACUUGCAGAAUAU
Get precursor sequence
Structure
        10        20          30        40        50        60   
AGAAAUGUCCUAGGAAGUAAU--|UG     C    UC    UU   CU  C    UGACUUUA 
                       U  UAUGU AGCC  UCAU  GGC  GC UAGC        A
                       A  GUGCA UCGG  AGUG  CCG  CG AUCG        A
UAUAAGACGUUCAACUUAGCGUU^GU     U    GA    UU   U-  -    UUAUAAUU 
    120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-22-P2_5p*

MirBase accessionNone
Sequence
0- AGCCUCUCAUUUGGCCUGCCUAGC -24
Get sequence
Mature sequence

Dan-Mir-22-P2_3p

MirBase accessionNone
Sequence
44- UAGCUGCCUUGUGAAGGGCUUA -66
Get sequence