MirGeneDB

MirGeneDB ID

Isc-Mir-96-P3

Family name MIR-96 (all species)
Seed AUGGCAC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-263a
Paralogues Isc-Mir-96-P1  Isc-Mir-96-P2 
Orthologues Aae-Mir-96-P3  Ami-Mir-96-P3-v1  Ami-Mir-96-P3-v2  Asu-Mir-96-P3  Bfl-Mir-96-P3  Bge-Mir-96-P3  Bta-Mir-96-P3-v1  Bta-Mir-96-P3-v2  Cbr-Mir-96-P3  Cel-Mir-96-P3  Cfa-Mir-96-P3-v1  Cfa-Mir-96-P3-v2  Cgi-Mir-96-P3  Cin-Mir-96-P3  Cli-Mir-96-P3-v1  Cli-Mir-96-P3-v2  Cpi-Mir-96-P3-v1  Cpi-Mir-96-P3-v2  Cpo-Mir-96-P3-v1  Cpo-Mir-96-P3-v2  Dan-Mir-96-P3  Dme-Mir-96-P3  Dmo-Mir-96-P3  Dno-Mir-96-P3-v1  Dno-Mir-96-P3-v2  Dpu-Mir-96-P3  Dre-Mir-96-P3-v1  Dre-Mir-96-P3-v2  Ete-Mir-96-P3-v1  Ete-Mir-96-P3-v2  Gga-Mir-96-P3-v1  Gga-Mir-96-P3-v2  Hme-Mir-96-P3  Hsa-Mir-96-P3-v1  Hsa-Mir-96-P3-v2  Lan-Mir-96-P3  Lgi-Mir-96-P3  Mdo-Mir-96-P3-v1  Mdo-Mir-96-P3-v2  Mml-Mir-96-P3-v1  Mml-Mir-96-P3-v2  Mmu-Mir-96-P3-v1  Mmu-Mir-96-P3-v2  Oan-Mir-96-P3-v1  Oan-Mir-96-P3-v2  Ocu-Mir-96-P3-v1  Ocu-Mir-96-P3-v2  Pfl-Mir-96-P3  Pmi-Mir-96-P3  Rno-Mir-96-P3-v1  Rno-Mir-96-P3-v2  Sha-Mir-96-P3-v1  Sha-Mir-96-P3-v2  Sko-Mir-96-P3  Spu-Mir-96-P3  Sto-Mir-96-P3-v1  Sto-Mir-96-P3-v2  Tca-Mir-96-P3  Tgu-Mir-96-P3  Xtr-Mir-96-P3-v1  Xtr-Mir-96-P3-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS633978: 93562-93624 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAUUUUUUUUGCCUUCCUACCUUCCGUCAAUGGCACUGGAAGAAUUCACGGGGUCUUGAUAGAAAUACCGUGACUUCUCCGGUGCUGUGGAUGGCGGCUAGGCCGACUUCAGCUUGAGCAG
Get precursor sequence
Structure
        10          20        30        40        50        60 
ACAAUUUUUUUUGCCUU--|   C  U     A           A   U      GGUCUUG 
                   CCUA CU CCGUC AUGGCACUGGA GAA UCACGG       A
                   GGAU GG GGUAG UGUCGUGGCCU CUU AGUGCC       U
GACGAGUUCGACUUCAGCC^   C  C     G           -   C      AUAAAGA 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-96-P3_5p

MirBase accessionMIMAT0012692
Sequence
0- AAUGGCACUGGAAGAAUUCACGG -23
Get sequence
Star sequence

Isc-Mir-96-P3_3p*

MirBase accessionNone
Sequence
41- GUGACUUCUCCGGUGCUGUGGA -63
Get sequence